| (1) AGO1.ip OTHER.mut | (2) AGO2.ip | (1) AGO3.ip | (2) B-CELL | (1) BRAIN | (7) BREAST | (28) CELL-LINE | (1) CERVIX | (5) HEART | (1) HELA | (2) LIVER | (1) OTHER | (8) SKIN | (1) TESTES | (1) UTERUS |
| TTATTAGTAATAAGCATGTATACCAATTTGTATCTACAAACCTATAATTTTTAAACTGTAGTATTCACGTAAATATTGGTAAGATATTTATTTTGGAATGTGGATGATTTGTAAAACCTGTGTATTAAAACAAAAGTATACAAATACCTGATTTGTACATACCTGGCTGTAACCTAATGTGTCTTTTTGTTGTCATGCAGAGCTCTGGTATCGAGACTTTAGTGGAGGAGCTCTGCTCCAGACTGAAAGA .............................................................(((((..(((((((((.....)))))))))....))))).((...(((((((..((...(((......)))...)).))))))).))........(((((...((......))...))))).................................................................... ...........................................................60..........................................................................................................................184................................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR037937(GSM510475) 293cand2. (cell line) | SRR037932(GSM510470) 293cand4_rep1. (cell line) | SRR037938(GSM510476) 293Red. (cell line) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR553576(SRX182782) source: Testis. (testes) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR037940(GSM510478) 293cand5_rep2. (cell line) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | SRR037936(GSM510474) 293cand1. (cell line) | DRR000562(DRX000320) Isolation of RNA following immunoprecipitatio. (ago3 cell line) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR040016(GSM532901) G645N. (cervix) | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR015447(SRR015447) nuclear small RNAs. (breast) | SRR207114(GSM721076) "IP against AGO 1 & 2, RRP40 knockdown". (ago1/2 RRP40 cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | TAX577742(Rovira) total RNA. (breast) | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | TAX577579(Rovira) total RNA. (breast) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR189786 | SRR060986(GSM569190) Human memory B cell [09-001]. (cell line) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR191550(GSM715660) 27genomic small RNA (size selected RNA from t. (breast) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR029124(GSM416753) HeLa. (hela) | SRR444068(SRX128916) Sample 25cDNABarcode: AF-PP-341: ACG CTC TTC . (cell line) | SRR191528(GSM715638) 130genomic small RNA (size selected RNA from . (breast) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | DRR000561(DRX000319) Isolation of RNA following immunoprecipitatio. (ago2 cell line) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR191542(GSM715652) 64genomic small RNA (size selected RNA from t. (breast) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR037943(GSM510481) 293DcrTN. (cell line) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR029128(GSM416757) H520. (cell line) | SRR330875(SRX091713) tissue: skin psoriatic involveddisease state:. (skin) | SRR037941(GSM510479) 293DroshaTN. (cell line) | SRR191600(GSM715710) 90genomic small RNA (size selected RNA from t. (breast) | SRR037934(GSM510472) 293cand4_rep3. (cell line) | SRR029131(GSM416760) MCF7. (cell line) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR553574(SRX182780) source: Heart. (Heart) | SRR037942(GSM510480) 293DroshaTN_cand5. (cell line) | SRR444062(SRX128910) Sample 27_3cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR444060(SRX128908) Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ................................................................TCACGTAAATATTGGCG......................................................................................................................................................................... | 17 | 2 | 177.50 | 13.50 | 162.00 | - | - | - | - | - | - | - | - | - | - | 0.50 | 1.50 | 1.50 | 1.50 | - | - | 1.00 | - | - | - | 1.00 | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 | - | - | - | - | 0.50 | - | 0.50 | - | - | 0.50 | 0.50 | - | - | - |
| ................................................................TCACGTAAATATTGGCGT........................................................................................................................................................................ | 18 | 2 | 54.50 | 13.50 | 12.00 | 31.00 | 4.50 | 2.50 | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | 0.50 | - | - | - | - | - | - |
| ................................................................TCACGTAAATATTGGCGA........................................................................................................................................................................ | 18 | 2 | 35.50 | 13.50 | 28.00 | 7.00 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................TCACGTAAATATTGG........................................................................................................................................................................... | 15 | 2 | 13.50 | 13.50 | 13.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................CACGTAAATATTGGTAGCAG..................................................................................................................................................................... | 20 | 4.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................TTATTTTGGAATGTGGATGATTTGTA......................................................................................................................................... | 26 | 1 | 3.00 | 3.00 | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................CACGTAAATATTGGTG......................................................................................................................................................................... | 16 | 3 | 3.00 | 0.33 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - |
| ................................................................TCACGTAAATATTGGCTT........................................................................................................................................................................ | 18 | 2 | 2.50 | 13.50 | - | - | 1.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | 0.50 | - | - | - | - | - |
| ................................................................TCACGTAAATATTGGCGC........................................................................................................................................................................ | 18 | 2 | 2.50 | 13.50 | 1.00 | 1.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................................................TCGAGACTTTAGTGGAGGAGCTCTGCTCC........... | 29 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................................................................TGGTATCGAGACTTTAGTGGAGGAGC................... | 26 | 1 | 2.00 | 2.00 | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................TCACGTAAATATTGGAGT........................................................................................................................................................................ | 18 | 2 | 1.50 | 13.50 | - | 1.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................TCACGTAAATATTGGCGTT....................................................................................................................................................................... | 19 | 2 | 1.50 | 13.50 | - | 0.50 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................................................................AGGAGCTCTGCTCCAGACTGA.... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................................................................AGACTTTAGTGGAGGAGCTCTGC.............. | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................................................................AGACTTTAGTGGAGGAGCTCTGCT............. | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................................................GTATCGAGACTTTAGTGGAGGA..................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................AATGTGTCTTTTTGTTGTCATGCAGA................................................. | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................................................TCGAGACTTTAGTGGAGGAGCTCTGC.............. | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................................................GTATCGAGACTTTAGTGGAGGAGCTCTG............... | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................................................................TCTGCTCCAGACTGAAAGGCG | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................TCACGTAAATATTGGTGT........................................................................................................................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................CATACCTGGCTGTAACCTAATGT...................................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................TCACGTAAATATTGGCGTA....................................................................................................................................................................... | 19 | 2 | 1.00 | 13.50 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................ATATTTATTTTGGAATGTGGATGATA............................................................................................................................................. | 26 | 1.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................TCACGTAAATATTGGAGA........................................................................................................................................................................ | 18 | 2 | 1.00 | 13.50 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................................CGAGACTTTAGTGGAGGAGCT.................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................................................................AGCTCTGCTCCAGACTGGC... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................ACGTAAATATTGGTAGCAG..................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................................................CGAGACTTTAGTGGAGGAGCTCTGCTCC........... | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................................................................CTGGTATCGAGACTTTAGTGGAGGAGC................... | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................................................GAGACTTTAGTGGAGGAGCTCTGCTC............ | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................GTGTCTTTTTGTTGTCATGCAG.................................................. | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................ATACCTGGCTGTAACCTAATG....................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................................................CTCTGGTATCGAGACTTTAGTGGAGG...................... | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................TCACGTAAATATTGGCCAC....................................................................................................................................................................... | 19 | 2 | 0.50 | 13.50 | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................TCACGTAAATATTGGAAT........................................................................................................................................................................ | 18 | 2 | 0.50 | 13.50 | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................TCACGTAAATATTGGCCT........................................................................................................................................................................ | 18 | 2 | 0.50 | 13.50 | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................TCACGTAAATATTGGCGAC....................................................................................................................................................................... | 19 | 2 | 0.50 | 13.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - |
| ................................................................TCACGTAAATATTGGCT......................................................................................................................................................................... | 17 | 2 | 0.50 | 13.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................TCACGTAAATATTGGC.......................................................................................................................................................................... | 16 | 2 | 0.50 | 13.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................TCACGTAAATATTGGCA......................................................................................................................................................................... | 17 | 2 | 0.50 | 13.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................TCACGTAAATATTGGCGAT....................................................................................................................................................................... | 19 | 2 | 0.50 | 13.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................................CGAGACTTTAGTGGAG....................... | 16 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................TCACGTAAATATTGGCTG........................................................................................................................................................................ | 18 | 2 | 0.50 | 13.50 | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................CACGTAAATATTGGTGTAT...................................................................................................................................................................... | 19 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - |
| .................................................................CACGTAAATATTGGTTTTT...................................................................................................................................................................... | 19 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................CACGTAAATATTGGT.......................................................................................................................................................................... | 15 | 3 | 0.33 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| TTATTAGTAATAAGCATGTATACCAATTTGTATCTACAAACCTATAATTTTTAAACTGTAGTATTCACGTAAATATTGGTAAGATATTTATTTTGGAATGTGGATGATTTGTAAAACCTGTGTATTAAAACAAAAGTATACAAATACCTGATTTGTACATACCTGGCTGTAACCTAATGTGTCTTTTTGTTGTCATGCAGAGCTCTGGTATCGAGACTTTAGTGGAGGAGCTCTGCTCCAGACTGAAAGA .............................................................(((((..(((((((((.....)))))))))....))))).((...(((((((..((...(((......)))...)).))))))).))........(((((...((......))...))))).................................................................... ...........................................................60..........................................................................................................................184................................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR037937(GSM510475) 293cand2. (cell line) | SRR037932(GSM510470) 293cand4_rep1. (cell line) | SRR037938(GSM510476) 293Red. (cell line) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR553576(SRX182782) source: Testis. (testes) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR037940(GSM510478) 293cand5_rep2. (cell line) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | SRR037936(GSM510474) 293cand1. (cell line) | DRR000562(DRX000320) Isolation of RNA following immunoprecipitatio. (ago3 cell line) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR040016(GSM532901) G645N. (cervix) | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR015447(SRR015447) nuclear small RNAs. (breast) | SRR207114(GSM721076) "IP against AGO 1 & 2, RRP40 knockdown". (ago1/2 RRP40 cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | TAX577742(Rovira) total RNA. (breast) | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | TAX577579(Rovira) total RNA. (breast) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR189786 | SRR060986(GSM569190) Human memory B cell [09-001]. (cell line) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR191550(GSM715660) 27genomic small RNA (size selected RNA from t. (breast) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR029124(GSM416753) HeLa. (hela) | SRR444068(SRX128916) Sample 25cDNABarcode: AF-PP-341: ACG CTC TTC . (cell line) | SRR191528(GSM715638) 130genomic small RNA (size selected RNA from . (breast) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | DRR000561(DRX000319) Isolation of RNA following immunoprecipitatio. (ago2 cell line) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR191542(GSM715652) 64genomic small RNA (size selected RNA from t. (breast) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR037943(GSM510481) 293DcrTN. (cell line) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR029128(GSM416757) H520. (cell line) | SRR330875(SRX091713) tissue: skin psoriatic involveddisease state:. (skin) | SRR037941(GSM510479) 293DroshaTN. (cell line) | SRR191600(GSM715710) 90genomic small RNA (size selected RNA from t. (breast) | SRR037934(GSM510472) 293cand4_rep3. (cell line) | SRR029131(GSM416760) MCF7. (cell line) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR553574(SRX182780) source: Heart. (Heart) | SRR037942(GSM510480) 293DroshaTN_cand5. (cell line) | SRR444062(SRX128910) Sample 27_3cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR444060(SRX128908) Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...........................................................................................................................ATTAAAACAAAAGTATTGT............................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................AATAAATATCTTACCA.............................................................................................................................................................. | 16 | 8 | 0.12 | 0.12 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.12 |