| (1) AGO2.ip | (1) BRAIN | (1) BREAST | (10) CELL-LINE | (5) HEART | (1) HELA | (1) LIVER | (1) OTHER | (37) SKIN | (1) TESTES |
| TCCAACAAAGTCCACCAATATGATGGGTCACCGGGTTGATTATTTTATTGGTAGGATTATATCAGTAAAATCGTATTAGTGTACATATGTTATGAAGTTAACCTACATTTGGGATATGTAGAAGTTTTAAAAGTGCTTTCCAAATGTGATTGTTCTGGTGATGGACATATGGCAGTTGATTATTCTGTTCTTTTCTTTTATGATTGAAAATGTCTATAATAAAAAGATAACATGTTTTCTAATAACAATT ..................................................(((((.(((.....((((....((((....)))).....)))).....))))))))................................................................................................................................................ ..................................................51............................................................................129....................................................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR029132(GSM416761) MB-MDA231. (cell line) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR343336 | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR189785 | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR037932(GSM510470) 293cand4_rep1. (cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553576(SRX182782) source: Testis. (testes) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR343337 | SRR037933(GSM510471) 293cand4_rep2. (cell line) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR189777(GSM714637) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR207116(GSM721078) Nuclear RNA. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..................................................GTAGGATTATATCAGTA....................................................................................................................................................................................... | 17 | 1 | 75.00 | 75.00 | 8.00 | 4.00 | 5.00 | 4.00 | 3.00 | 4.00 | 4.00 | 3.00 | 3.00 | 2.00 | 1.00 | 2.00 | - | 1.00 | 1.00 | - | 2.00 | 2.00 | 1.00 | 2.00 | 2.00 | - | 2.00 | - | - | - | - | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | 1.00 | 1.00 | - | 1.00 | 1.00 | 1.00 | 1.00 | - | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | - | - | - | 1.00 | - | - |
| ........................................TATTTTATTGGTAGGATTATATCAGTA....................................................................................................................................................................................... | 27 | 1 | 3.00 | 3.00 | - | 1.00 | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................TATTGGTAGGATTATATCAGTA....................................................................................................................................................................................... | 22 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................CACCGGGTTGATTATTTTATTGGTAGGATTAT.............................................................................................................................................................................................. | 32 | 1 | 2.00 | 2.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................TTGGGATATGTAGAAAA............................................................................................................................. | 17 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......AAGTCCACCAATATGATGG................................................................................................................................................................................................................................ | 19 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................ATTTTATTGGTAGGATT................................................................................................................................................................................................ | 17 | 2 | 1.50 | 1.50 | - | - | - | 1.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................AGGATTATATCAGTAGT..................................................................................................................................................................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................TTTGGGATATGTAGAAGTTTTAAAAGTGCTTTC.............................................................................................................. | 33 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................ATGGGTCACCGGGTTGATTATTTTATTG........................................................................................................................................................................................................ | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................................TTTTCTTTTATGATTCCCC......................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................ATATGATGGGTCACCGGGTT..................................................................................................................................................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - |
| ......................ATGGGTCACCGGGTTGATTATTTTACTGC....................................................................................................................................................................................................... | 29 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............CCAATATGATGGGTCACCGGGTTG.................................................................................................................................................................................................................... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - |
| .......................TGGGTCACCGGGTTGATTA................................................................................................................................................................................................................ | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....CAAAGTCCACCAATATGATGGGTCACCGG........................................................................................................................................................................................................................ | 29 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................CCGGGTTGATTATTTTATTGC....................................................................................................................................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................TGGTGATGGACATATGGCAG........................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................TGGGATATGTAGAAGTTTTAAAAGTGC.................................................................................................................. | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................ATTGGTAGGATTATATCAGCA....................................................................................................................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................................................................................................TTTTCTAATAACAATCTAG | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | |
| ......................ATGGGTCACCGGGTTGATTATTTTATTGCT...................................................................................................................................................................................................... | 30 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................CACCGGGTTGATTATTTTATTGCT...................................................................................................................................................................................................... | 24 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................GGGATATGTAGAAGTTTG.......................................................................................................................... | 18 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................TTCTGTTCTTTTCTTTTAC................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................TACATTTGGGATATGTAGAAGTT............................................................................................................................ | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - |
| ...........CCACCAATATGATGGGTCACCGGGT...................................................................................................................................................................................................................... | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................ACCGGGTTGATTATTTTATTGCT...................................................................................................................................................................................................... | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................TATGATGGGTCACCGGGTTGATT................................................................................................................................................................................................................. | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................................................TTGAAAATGTCTATAATAAAAAG........................ | 23 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 |
| TCCAACAAAGTCCACCAATATGATGGGTCACCGGGTTGATTATTTTATTGGTAGGATTATATCAGTAAAATCGTATTAGTGTACATATGTTATGAAGTTAACCTACATTTGGGATATGTAGAAGTTTTAAAAGTGCTTTCCAAATGTGATTGTTCTGGTGATGGACATATGGCAGTTGATTATTCTGTTCTTTTCTTTTATGATTGAAAATGTCTATAATAAAAAGATAACATGTTTTCTAATAACAATT ..................................................(((((.(((.....((((....((((....)))).....)))).....))))))))................................................................................................................................................ ..................................................51............................................................................129....................................................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR029132(GSM416761) MB-MDA231. (cell line) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR343336 | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR189785 | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR037932(GSM510470) 293cand4_rep1. (cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553576(SRX182782) source: Testis. (testes) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR343337 | SRR037933(GSM510471) 293cand4_rep2. (cell line) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR189777(GSM714637) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR207116(GSM721078) Nuclear RNA. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ....................................................................................................................TGTAGAAGTTTTAAAACC.................................................................................................................... | 18 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | |
| ......................................................................................................................................................................ATATGGCAGTTGATTATG.................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |