| (1) B-CELL | (16) BREAST | (6) CELL-LINE | (1) CERVIX | (1) FIBROBLAST | (4) HEART | (1) KIDNEY | (4) LIVER | (2) OTHER | (15) SKIN | (3) UTERUS | (1) XRN.ip |
| ACTTGTATAAAATGTGAGACATAGCAGTCACCTACCCTTCAACAAAGCACAGAGGGCTTGCTGAGAACTTAATTCCAGGCTGGACAACAATTATCCCTCTTTTCAAGGACATTTTGTTCTCATCTTTGCCCTCTTCTTATTTTTAATGGTATATGTACGAGGAATAGATTAAAAGATAATCATTTTTATTCACTTTGCAGGACAAGTCTTGGGGACTAGATAAAATGGGCAGGAACATTTAATCCTCTGC .............................................................(((((((..(((((((((..(((.........)))..))).....))).)))..))))))).......((((....((((......)))).......))))....(((((.....)))))..................................................................... ........................................................57..........................................................................................................................181................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR189785 | SRR330875(SRX091713) tissue: skin psoriatic involveddisease state:. (skin) | SRR189782 | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR189784 | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | TAX577740(Rovira) total RNA. (breast) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR015447(SRR015447) nuclear small RNAs. (breast) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR343334 | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR191451(GSM715561) 177genomic small RNA (size selected RNA from . (breast) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR191529(GSM715639) 131genomic small RNA (size selected RNA from . (breast) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR189787 | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | SRR191519(GSM715629) 86genomic small RNA (size selected RNA from t. (breast) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR037937(GSM510475) 293cand2. (cell line) | SRR330909(SRX091747) tissue: normal skindisease state: normal. (skin) | SRR363675(GSM830252) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191570(GSM715680) 56genomic small RNA (size selected RNA from t. (breast) | SRR191418(GSM715528) 40genomic small RNA (size selected RNA from t. (breast) | TAX577590(Rovira) total RNA. (breast) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | TAX577742(Rovira) total RNA. (breast) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR343335 | TAX577579(Rovira) total RNA. (breast) | SRR191505(GSM715615) 139genomic small RNA (size selected RNA from . (breast) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191453(GSM715563) 179genomic small RNA (size selected RNA from . (breast) | SRR040043(GSM532928) G428T. (cervix) | TAX577738(Rovira) total RNA. (breast) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR191458(GSM715568) 28genomic small RNA (size selected RNA from t. (breast) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR189778(GSM714638) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191550(GSM715660) 27genomic small RNA (size selected RNA from t. (breast) | SRR039624(GSM531987) HBV(-) HCV(-) Adjacent Tissue Sample. (liver) | TAX577743(Rovira) total RNA. (breast) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR038852(GSM458535) QF1160MB. (cell line) | SRR444055(SRX128903) Sample 27_2cDNABarcode: AF-PP-343: ACG CTC TT. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .............................................................TGAGAACTTAATTCCATAGG......................................................................................................................................................................... | 20 | 25.00 | 0.00 | - | 6.00 | - | 4.00 | - | - | 2.00 | 2.00 | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | 1.00 | - | - | - | - | - | 1.00 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | |
| .............................................................TGAGAACTTAATTCCATGGG......................................................................................................................................................................... | 20 | 15.00 | 0.00 | - | 6.00 | - | - | - | - | - | - | 1.00 | - | 2.00 | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | |
| .............................................................TGAGAACTTAATTCCATAG.......................................................................................................................................................................... | 19 | 10.00 | 0.00 | 2.00 | - | 5.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................TGAGAACTTAATTCCATGG.......................................................................................................................................................................... | 19 | 9.00 | 0.00 | - | 5.00 | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................GAGGAATAGATTAAACTGT......................................................................... | 19 | 7.00 | 0.00 | 7.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................TGAGAACTTAATTCCATA........................................................................................................................................................................... | 18 | 7.00 | 0.00 | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | |
| ..........................................................................................................................................................GTACGAGGAATAGATTAAACTGT......................................................................... | 23 | 7.00 | 0.00 | 7.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................CGAGGAATAGATTAAACTGT......................................................................... | 20 | 6.00 | 0.00 | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................TGAGAACTTAATTCCATG........................................................................................................................................................................... | 18 | 3.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................TGAGAACTTAATTCCATATG......................................................................................................................................................................... | 20 | 3.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................GAGGAATAGATTAAACTGA......................................................................... | 19 | 2.00 | 0.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................AATGGTATATGTACGAG......................................................................................... | 17 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................AGAGGGCTTGCTGAGAAC...................................................................................................................................................................................... | 18 | 2 | 1.50 | 1.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - |
| ............................................AAGCACAGAGGGCTTGCTGAGAACCT.................................................................................................................................................................................... | 26 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................................AAAAGATAATCATTTCGTG............................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................TCTTTTCAAGGACATTTTGTTC................................................................................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................TGAGAACTTAATTCCATGC.......................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................TGAGAACTTAATTCCATGT.......................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................CTTTTCAAGGACATTTTGTTC................................................................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - |
| .............................................................TGAGAACTTAATTCCAGAGG......................................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................TGAGAACTTAATTCCATTG.......................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................................................ATTTTTATTCACTTTGCATAAG............................................... | 22 | 1.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................TGAGAACTTAATTCCATAGT......................................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................CTTTTCAAGGACATTTTGTTCTCA................................................................................................................................ | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................TGAGAACTTAATTCCATAGA......................................................................................................................................................................... | 20 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................GTACGAGGAATAGATTAAACTGC......................................................................... | 23 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................TGAGAACTTAATTCCATGTG......................................................................................................................................................................... | 20 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................AAGCACAGAGGGCTTGCTGAGAACCC.................................................................................................................................................................................... | 26 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................CGAGGAATAGATTAAACGGA......................................................................... | 20 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................TGAGAACTTAATTCCATAAG......................................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................ACGAGGAATAGATTAAACTGA......................................................................... | 21 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................TTTTTATTCACTTTGCAGGACA.............................................. | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................ATAATCATTTTTATTCACTTTGCAGGACAAGTC.......................................... | 33 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - |
| ..............................................................GAGAACTTAATTCCATGG.......................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................CGAGGAATAGATTAAACTGA......................................................................... | 20 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................GAGAACTTAATTCCATGGG......................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................TGAGAACTTAATTCCGAAC.......................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................TGAGAACTTAATTCCACAT.......................................................................................................................................................................... | 19 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................AATGGTATATGTACGAGGAATAGATTAAA............................................................................. | 29 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................GTACGAGGAATAGATTAACTGT.......................................................................... | 22 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................CATTTTTATTCACTTTGCATAAG............................................... | 23 | 1.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................GAGGAATAGATTAAAATGT......................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................CATTTTTATTCACTTTGCATA................................................. | 21 | 1.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................GTACGAGGAATAGATTAAATTGT......................................................................... | 23 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................TTCAACAAAGCACAGAGGTATG............................................................................................................................................................................................... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................CTTCAACAAAGCACAGAGGGCTTGCTGA.......................................................................................................................................................................................... | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................CGAGGAATAGATTAAAATGT......................................................................... | 20 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................AGAGGGCTTGCTGAGAACTTAAT................................................................................................................................................................................. | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................GTACGAGGAATAGATTAAACTGG......................................................................... | 23 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................TGAGAACTTAATTCCCA............................................................................................................................................................................ | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................AAGCACAGAGGGCTTGCTGAGAA....................................................................................................................................................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................................TTGCAGGACAAGTCTTGGGGACTAGA.............................. | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................GGGCTTGCTGAGAACTTAATT................................................................................................................................................................................ | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - |
| ACTTGTATAAAATGTGAGACATAGCAGTCACCTACCCTTCAACAAAGCACAGAGGGCTTGCTGAGAACTTAATTCCAGGCTGGACAACAATTATCCCTCTTTTCAAGGACATTTTGTTCTCATCTTTGCCCTCTTCTTATTTTTAATGGTATATGTACGAGGAATAGATTAAAAGATAATCATTTTTATTCACTTTGCAGGACAAGTCTTGGGGACTAGATAAAATGGGCAGGAACATTTAATCCTCTGC .............................................................(((((((..(((((((((..(((.........)))..))).....))).)))..))))))).......((((....((((......)))).......))))....(((((.....)))))..................................................................... ........................................................57..........................................................................................................................181................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR189785 | SRR330875(SRX091713) tissue: skin psoriatic involveddisease state:. (skin) | SRR189782 | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR189784 | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | TAX577740(Rovira) total RNA. (breast) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR015447(SRR015447) nuclear small RNAs. (breast) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR343334 | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR191451(GSM715561) 177genomic small RNA (size selected RNA from . (breast) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR191529(GSM715639) 131genomic small RNA (size selected RNA from . (breast) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR189787 | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | SRR191519(GSM715629) 86genomic small RNA (size selected RNA from t. (breast) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR037937(GSM510475) 293cand2. (cell line) | SRR330909(SRX091747) tissue: normal skindisease state: normal. (skin) | SRR363675(GSM830252) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191570(GSM715680) 56genomic small RNA (size selected RNA from t. (breast) | SRR191418(GSM715528) 40genomic small RNA (size selected RNA from t. (breast) | TAX577590(Rovira) total RNA. (breast) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | TAX577742(Rovira) total RNA. (breast) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR343335 | TAX577579(Rovira) total RNA. (breast) | SRR191505(GSM715615) 139genomic small RNA (size selected RNA from . (breast) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191453(GSM715563) 179genomic small RNA (size selected RNA from . (breast) | SRR040043(GSM532928) G428T. (cervix) | TAX577738(Rovira) total RNA. (breast) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR191458(GSM715568) 28genomic small RNA (size selected RNA from t. (breast) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR189778(GSM714638) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191550(GSM715660) 27genomic small RNA (size selected RNA from t. (breast) | SRR039624(GSM531987) HBV(-) HCV(-) Adjacent Tissue Sample. (liver) | TAX577743(Rovira) total RNA. (breast) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR038852(GSM458535) QF1160MB. (cell line) | SRR444055(SRX128903) Sample 27_2cDNABarcode: AF-PP-343: ACG CTC TT. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ....................................................................................................................................................................TAGATTAAAAGATAATCC.................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | |
| ......................................................................................................................AAGAGGGCAAAGATGAG................................................................................................................... | 17 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 |