| (1) AGO2.ip | (4) B-CELL | (8) BRAIN | (7) BREAST | (8) CELL-LINE | (2) CERVIX | (1) HELA | (2) OTHER | (5) SKIN | (1) TESTES | (2) UTERUS |
| CAGCCCCACACCGGCTTTGCCACCACACAGGCTGTTGAGGCAGGAGGCGGGTAAGACGTAGCTGTAGACCCAAAGCAACCACCAGCCCTGGGACCCTGTGGGAGAGGAGCACTTTTAGAACATGGAAAAGTGTGGTCATCCCATCATTAGACAGCACACATCCTACATAAATAAAAAGTCGTATGGGGAAGGAGGTTGGGGAGGGAATAAAAAATTGGCACAGACATTGATAGACTGGTTTCCAGTTTCA .....................................................................................(((...((((..((((((.....((((((((.........)))))))).....))))))................((((.((((............))))))))....))))))).................................................. ....................................................................................85.................................................................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | SRR189782 | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | GSM450610(GSM450610) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | TAX577589(Rovira) total RNA. (breast) | SRR189784 | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | GSM450609(GSM450609) miRNA sequencing raw reads from post-mortem s. (brain) | SRR189785 | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | GSM450606(GSM450606) miRNA sequencing raw reads from post-mortem s. (brain) | TAX577580(Rovira) total RNA. (breast) | GSM450607(GSM450607) miRNA sequencing raw reads from post-mortem s. (brain) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR189787 | SRR444065(SRX128913) Sample 22cDNABarcode: AF-PP-335: ACG CTC TTC . (cell line) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | DRR001486(DRX001040) "Hela long cytoplasmic cell fraction, LNA(+)". (hela) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | TAX577579(Rovira) total RNA. (breast) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | SRR060986(GSM569190) Human memory B cell [09-001]. (cell line) | TAX577453(Rovira) total RNA. (breast) | GSM532886(GSM532886) G850T. (cervix) | SRR040035(GSM532920) G001T. (cervix) | TAX577743(Rovira) total RNA. (breast) | SRR038852(GSM458535) QF1160MB. (cell line) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR015447(SRR015447) nuclear small RNAs. (breast) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR553576(SRX182782) source: Testis. (testes) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .......................................................................................................................................................................................TGGGGAAGGAGGTTGTAT................................................. | 18 | 6.00 | 0.00 | 2.00 | - | - | 1.00 | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................GGGACCCTGTGGGAGAGTAG............................................................................................................................................. | 20 | 6.00 | 0.00 | - | - | - | - | 3.00 | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................TGGGGAAGGAGGTTGGGTGGT.............................................. | 21 | 3.00 | 0.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................TGGGGAAGGAGGTTGGGTAGT.............................................. | 21 | 3.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................TGGGGAAGGAGGTTGTATA................................................ | 19 | 3.00 | 0.00 | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................TGGGGAAGGAGGTTGTTT................................................. | 18 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................................GGGAGGGAATAAAAAAAAAA................................ | 20 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................TGGGGAAGGAGGTTGTAAA................................................ | 19 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................TGGGGAAGGAGGTTGGATAG............................................... | 20 | 2.00 | 0.00 | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................TGGGGAAGGAGGTTGTA.................................................. | 17 | 2.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................TGGGGAAGGAGGTTGTTTT................................................ | 19 | 2.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................GGGACCCTGTGGGAGAGTAGG............................................................................................................................................ | 21 | 2.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................TGGGGAAGGAGGTTGGGTGGG.............................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................GGGACCCTGTGGGAGAGTA.............................................................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | |
| ...................................TGAGGCAGGAGGCGGTGT..................................................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................TGAGGCAGGAGGCGGTATA.................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................TGAGGCAGGAGGCGGGATG.................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................TGAGGCAGGAGGCGGGTAG.................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................TGGGGAAGGAGGTTGTGGG................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................TGGGGAAGGAGGTTGGGTGT............................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................TGGGGAAGGAGGTTGTGT................................................. | 18 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................TGGGGAAGGAGGTTGTGTG................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................TGAGGCAGGAGGCGGTGGA.................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................TGGGGAAGGAGGTTGTTTA................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................TGAGGCAGGAGGCGGATAA.................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................................GGAGGTTGGGGAGGGAATATGC...................................... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................TGGGGAAGGAGGTTGGGGGGT.............................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................TGGGGAAGGAGGTTGGGGGGGT............................................. | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................TGGGGAAGGAGGTTGGAGGG............................................... | 20 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................TGGGGAAGGAGGTTGGGCTGT.............................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................GGACCCTGTGGGAGAGGAGGA........................................................................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................GCCCTGGGACCCTGTAAGC................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................GGGACCCTGTGGGAGAGCAGG............................................................................................................................................ | 21 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................TGGGGAAGGAGGTTGGGAGG............................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................TGGGGAAGGAGGTTGGAGAG............................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................TGGGGAAGGAGGTTGTGG................................................. | 18 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................GCAGGAGGCGGGTAAGACG................................................................................................................................................................................................ | 19 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 | - | - | - | - | - | - | - | - |
| ..............................................GCGGGTAAGACGTAGCTGTA........................................................................................................................................................................................ | 20 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 | - | - | - | - | - | - | - | - |
| ..............................................GCGGGTAAGACGTAGCTGT......................................................................................................................................................................................... | 19 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 | - | - | - | - | - | - | - | - |
| ..............................................GCGGGTAAGACGTAGCTG.......................................................................................................................................................................................... | 18 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 | - | - | - | - | - | - | - | - |
| ..........................................................TAGCTGTAGACCCAAAGC.............................................................................................................................................................................. | 18 | 9 | 0.11 | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 | - | - | - | - |
| ......................................................GACGTAGCTGTAGACCCAAAGC.............................................................................................................................................................................. | 22 | 9 | 0.11 | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 |
| ...................................................TAAGACGTAGCTGTAGACCCAAAGCAA............................................................................................................................................................................ | 27 | 9 | 0.11 | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 | - |
| CAGCCCCACACCGGCTTTGCCACCACACAGGCTGTTGAGGCAGGAGGCGGGTAAGACGTAGCTGTAGACCCAAAGCAACCACCAGCCCTGGGACCCTGTGGGAGAGGAGCACTTTTAGAACATGGAAAAGTGTGGTCATCCCATCATTAGACAGCACACATCCTACATAAATAAAAAGTCGTATGGGGAAGGAGGTTGGGGAGGGAATAAAAAATTGGCACAGACATTGATAGACTGGTTTCCAGTTTCA .....................................................................................(((...((((..((((((.....((((((((.........)))))))).....))))))................((((.((((............))))))))....))))))).................................................. ....................................................................................85.................................................................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | SRR189782 | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | GSM450610(GSM450610) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | TAX577589(Rovira) total RNA. (breast) | SRR189784 | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | GSM450609(GSM450609) miRNA sequencing raw reads from post-mortem s. (brain) | SRR189785 | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | GSM450606(GSM450606) miRNA sequencing raw reads from post-mortem s. (brain) | TAX577580(Rovira) total RNA. (breast) | GSM450607(GSM450607) miRNA sequencing raw reads from post-mortem s. (brain) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR189787 | SRR444065(SRX128913) Sample 22cDNABarcode: AF-PP-335: ACG CTC TTC . (cell line) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | DRR001486(DRX001040) "Hela long cytoplasmic cell fraction, LNA(+)". (hela) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | TAX577579(Rovira) total RNA. (breast) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | SRR060986(GSM569190) Human memory B cell [09-001]. (cell line) | TAX577453(Rovira) total RNA. (breast) | GSM532886(GSM532886) G850T. (cervix) | SRR040035(GSM532920) G001T. (cervix) | TAX577743(Rovira) total RNA. (breast) | SRR038852(GSM458535) QF1160MB. (cell line) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR015447(SRR015447) nuclear small RNAs. (breast) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR553576(SRX182782) source: Testis. (testes) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .......................................................................................................................................................................................................................................AGACTGGTTTCCAGTTTGCCC | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................AGTCGTATGGGGAAGGAGGTTGGGGAGGGAAC.......................................... | 32 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................CATTAGACAGCACACATCCTACC................................................................................... | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................................................GGTTGGGGAGGGAATGAAC...................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................ACCACCAGCCCTGGGACCCTGCGCT.................................................................................................................................................... | 25 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................................................TATTTATGTAGGATGTGTGC............................................................................. | 20 | 9 | 0.22 | 0.22 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 | - | - | 0.11 | - | - |
| ...........................................................................CAGGGTCCCAGGGCTGGTGGTTG........................................................................................................................................................ | 23 | 9 | 0.22 | 0.22 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.22 | - | - | - | - | - | - | - |
| ................CCTCAACAGCCTGTGTGGTGGCAA.................................................................................................................................................................................................................. | 24 | 8 | 0.12 | 0.12 | - | - | - | - | - | - | - | - | 0.12 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................................TCTATCAATGTCTGTGCCAATTT................ | 23 | 8 | 0.12 | 0.12 | - | 0.12 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................................................TATCAATGTCTGTGCCAATTTTTT.................. | 24 | 8 | 0.12 | 0.12 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.12 | - | - | - | - | - | - |
| ..........................................................................CCAGGGCTGGTGGTTGC............................................................................................................................................................... | 17 | 9 | 0.11 | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 | - | - | - | - | - | - | - |
| .....................................................................GGCTGGTGGTTGCTTTGG................................................................................................................................................................... | 18 | 9 | 0.11 | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................TTATTTATGTAGGATGTGTGCTG............................................................................ | 23 | 9 | 0.11 | 0.11 | - | - | - | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................................................CTTTTTATTTATGTAGGATGTGTGC........................................................................ | 25 | 9 | 0.11 | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 | - | - | - |
| ...........................................................................................................................................TTTATGTAGGATGTGTGCTGTCTAATGATGGG............................................................................... | 32 | 9 | 0.11 | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |