| (1) AGO1.ip | (1) AGO1.ip OTHER.mut | (1) AGO2.ip | (16) B-CELL | (5) BRAIN | (9) BREAST | (19) CELL-LINE | (1) CERVIX | (1) HEART | (2) HELA | (1) KIDNEY | (2) LIVER | (1) OTHER | (1) RRP40.ip | (7) SKIN | (1) XRN.ip |
| CAATGTGGAGCAGTGGCGGTGTGTCTCTATCCTCCGGAATCATTCAGGCGGTGAGTGGGACTGCCTGTTGGGGTGGGTGGGCCCCTGACACCTGGCTCAGATCAGCAGCACCGCCACGTCCCCTGTGGGACTGTTTGGTCCTTAAAGCAGCCCTATGTCTGGGCTGTCCCACCCCATCACAATCAGTCACACCCTGCCTGTCCCTTAAGATCTGTGCAGTCACCGGGTCCACTACCTGTCTCCAGCTGCA .............................................................................................((..(((....((((.....(((((.....)))))(((((.(((.........(((((((.......)))))))............))).))))).....)))))))..)).............................................. .......................................................................................88......................................................................................................................208........................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR015363(GSM380328) Germinal Center B cell (GC40). (B cell) | SRR015361(GSM380326) Memory B cells (MM55). (B cell) | SRR207113(GSM721075) IP against AGO 1 & 2. (ago1/2 cell line) | SRR037937(GSM510475) 293cand2. (cell line) | SRR015358(GSM380323) NaÌøve B Cell (Naive39). (B cell) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR207114(GSM721076) "IP against AGO 1 & 2, RRP40 knockdown". (ago1/2 RRP40 cell line) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | SRR060984(GSM569188) Human plasma cell [09-001]. (cell line) | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR015360(GSM380325) Plasma B cells (PC137). (B cell) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR189784 | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | TAX577740(Rovira) total RNA. (breast) | SRR015364(GSM380329) Plasma B cells (PC44). (B cell) | SRR033726(GSM497071) Mututated CLL (CLLM633). (B cell) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | SRR015359(GSM380324) Germinal Center B cell (GC136). (B cell) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | TAX577746(Rovira) total RNA. (breast) | GSM450607(GSM450607) miRNA sequencing raw reads from post-mortem s. (brain) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | SRR040028(GSM532913) G026N. (cervix) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR033724(GSM497069) L428 cell line (L428). (B cell) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell) | TAX577739(Rovira) total RNA. (breast) | TAX577741(Rovira) total RNA. (breast) | SRR038854(GSM458537) MM653. (cell line) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR038859(GSM458542) MM386. (cell line) | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | SRR038860(GSM458543) MM426. (cell line) | GSM450600(GSM450600) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | TAX577744(Rovira) total RNA. (breast) | TAX577589(Rovira) total RNA. (breast) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | TAX577738(Rovira) total RNA. (breast) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR038856(GSM458539) D11. (cell line) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | TAX577745(Rovira) total RNA. (breast) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR033731(GSM497076) h929 Cell line (h929). (B cell) | SRR039637(GSM518474) THP1_total_sRNAs. (cell line) | SRR553574(SRX182780) source: Heart. (Heart) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ............................................................................................TGGCTCAGATCAGCAGTAAC.......................................................................................................................................... | 20 | 7.00 | 0.00 | - | - | 3.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | |
| ............................................................................................TGGCTCAGATCAGCAGCAACAG........................................................................................................................................ | 22 | 6.00 | 0.00 | - | - | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................TGGCTCAGATCAGCAGCAAC.......................................................................................................................................... | 20 | 6.00 | 0.00 | - | - | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................TGGCTCAGATCAGCAGCAACA......................................................................................................................................... | 21 | 3.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................TGGCTCAGATCAGCAGAAAC.......................................................................................................................................... | 20 | 3.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................TGGCTCAGATCAGCAGCAA........................................................................................................................................... | 19 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | |
| ............................................................................................TGGCTCAGATCAGCAGTCAC.......................................................................................................................................... | 20 | 2.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................TGGCTCAGATCAGCAGCAAA.......................................................................................................................................... | 20 | 2.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................TGGCTCAGATCAGCAGATTC.......................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................TGGCTCAGATCAGCATGAA........................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................GCCTGTTGGGGTGGGTGGGCCCCTCT.................................................................................................................................................................. | 26 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........CAGTGGCGGTGTGTCTCTA............................................................................................................................................................................................................................. | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................TGGCTCAGATCAGCAGCACA.......................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................TGGCTCAGATCAGCAGCACC.......................................................................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................CAGTCACACCCTGCCTGTCCC.............................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................TGGCTCAGATCAGCAGCAACAA........................................................................................................................................ | 22 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................CTCTATCCTCCGGAATCACTC............................................................................................................................................................................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................TGGCTCAGATCAGCACGAC........................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................TCCGGAATCATTCAGGCG........................................................................................................................................................................................................ | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................TGGGACTGCCTGTTGGGGTA............................................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | |
| ............................................................................................TGGCTCAGATCAGCAAGAA........................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................GGCTCAGATCAGCAGAAAC.......................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................TGGCTCAGATCAGCAGAAA........................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................GAGTGGGACTGCCTGTTTCCC................................................................................................................................................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................TGGCTCAGATCAGCAGTTTC.......................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................TGGCTCAGATCAGCAGCAAG.......................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................................ACCCCATCACAATCAGTCACACC......................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................GGACTGCCTGTTGGGGTGG.............................................................................................................................................................................. | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................TGGCTCAGATCAGCAGCAAAAA........................................................................................................................................ | 22 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................GGCCCCTGACACCTGTGGG........................................................................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | |
| ............................................................................................TGGCTCAGATCAGCAGCAACAC........................................................................................................................................ | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................TGGCTCAGATCAGCAGTGTC.......................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................TGTGTCTCTATCCTCCGGAATCATTCA............................................................................................................................................................................................................ | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................TGGCTCAGATCAGCAGCTTT.......................................................................................................................................... | 20 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................TGGCTCAGATCAGCAGCTTC.......................................................................................................................................... | 20 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................TGGCTCAGATCAGCAGC............................................................................................................................................. | 17 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................TGGCTCAGATCAGCAGCTAC.......................................................................................................................................... | 20 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................GTGGGACTGTTTGGT............................................................................................................... | 15 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 |
| CAATGTGGAGCAGTGGCGGTGTGTCTCTATCCTCCGGAATCATTCAGGCGGTGAGTGGGACTGCCTGTTGGGGTGGGTGGGCCCCTGACACCTGGCTCAGATCAGCAGCACCGCCACGTCCCCTGTGGGACTGTTTGGTCCTTAAAGCAGCCCTATGTCTGGGCTGTCCCACCCCATCACAATCAGTCACACCCTGCCTGTCCCTTAAGATCTGTGCAGTCACCGGGTCCACTACCTGTCTCCAGCTGCA .............................................................................................((..(((....((((.....(((((.....)))))(((((.(((.........(((((((.......)))))))............))).))))).....)))))))..)).............................................. .......................................................................................88......................................................................................................................208........................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR015363(GSM380328) Germinal Center B cell (GC40). (B cell) | SRR015361(GSM380326) Memory B cells (MM55). (B cell) | SRR207113(GSM721075) IP against AGO 1 & 2. (ago1/2 cell line) | SRR037937(GSM510475) 293cand2. (cell line) | SRR015358(GSM380323) NaÌøve B Cell (Naive39). (B cell) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR207114(GSM721076) "IP against AGO 1 & 2, RRP40 knockdown". (ago1/2 RRP40 cell line) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | SRR060984(GSM569188) Human plasma cell [09-001]. (cell line) | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR015360(GSM380325) Plasma B cells (PC137). (B cell) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR189784 | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | TAX577740(Rovira) total RNA. (breast) | SRR015364(GSM380329) Plasma B cells (PC44). (B cell) | SRR033726(GSM497071) Mututated CLL (CLLM633). (B cell) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | SRR015359(GSM380324) Germinal Center B cell (GC136). (B cell) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | TAX577746(Rovira) total RNA. (breast) | GSM450607(GSM450607) miRNA sequencing raw reads from post-mortem s. (brain) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | SRR040028(GSM532913) G026N. (cervix) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR033724(GSM497069) L428 cell line (L428). (B cell) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell) | TAX577739(Rovira) total RNA. (breast) | TAX577741(Rovira) total RNA. (breast) | SRR038854(GSM458537) MM653. (cell line) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR038859(GSM458542) MM386. (cell line) | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | SRR038860(GSM458543) MM426. (cell line) | GSM450600(GSM450600) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | TAX577744(Rovira) total RNA. (breast) | TAX577589(Rovira) total RNA. (breast) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | TAX577738(Rovira) total RNA. (breast) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR038856(GSM458539) D11. (cell line) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | TAX577745(Rovira) total RNA. (breast) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR033731(GSM497076) h929 Cell line (h929). (B cell) | SRR039637(GSM518474) THP1_total_sRNAs. (cell line) | SRR553574(SRX182780) source: Heart. (Heart) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...................................................................................................................................................................................................GCCTGTCCCTTAAGACTC..................................... | 18 | 43.00 | 0.00 | 10.00 | 1.00 | - | - | 1.00 | - | - | - | 3.00 | 3.00 | 3.00 | - | 3.00 | 2.00 | - | - | - | - | - | - | 1.00 | - | 1.00 | 2.00 | - | 1.00 | - | - | - | - | - | 1.00 | - | - | 1.00 | - | 1.00 | - | 1.00 | - | - | 1.00 | - | - | 1.00 | 1.00 | - | 1.00 | - | 1.00 | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | |
| ...................................................................................................................................................................................................GCCTGTCCCTTAAGACT...................................... | 17 | 15.00 | 0.00 | - | 6.00 | - | - | 5.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................................GCCTGTCCCTTAAGACTCC.................................... | 19 | 10.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 2.00 | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | |
| ............................................................................................................................................................................CCCATCACAATCAGTAA............................................................. | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |