| (1) AGO2.ip | (11) B-CELL | (2) BRAIN | (3) BREAST | (20) CELL-LINE | (2) CERVIX | (1) FIBROBLAST | (5) HEART | (3) LIVER | (1) OTHER | (19) SKIN | (1) UTERUS |
| AGCAGCGCTTCAACATCATGTGCAACCACCTGAGGTTCAACCTGCCTCAGGTACCGCGGGCCTGCTGGGGAGGAGGGCGGGCTGCAGCCGTGCCTGTGGCTGTGGGTCTGGGTGGTGTAGCCTGGAGGCTGGAGAGAAGGAGTGTAAGGCTTGGGGGCGGGGCGTGCAGAAGGCGGGTTGGGAGGGCCTGGGCCGCACGCCCTGCTGAGCCAACCCCTGCCCCTCCAGGCGGCCAGTCGCCTGCCGTTGC .....................................................((((...(((.((....)).))))))).(((((((((......))))))))).((..(((......)))..))............................................................................................................................ ..................................................51...........................................................................128........................................................................................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR390724(GSM850203) small rna immunoprecipitated. (cell line) | SRR343334 | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR343335 | SRR189784 | SRR189787 | SRR189785 | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | GSM532876(GSM532876) G547T. (cervix) | SRR039615(GSM531978) Severe Chronic Hepatitis B Liver Tissue. (liver) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR015359(GSM380324) Germinal Center B cell (GC136). (B cell) | SRR444055(SRX128903) Sample 27_2cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR444062(SRX128910) Sample 27_3cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | SRR189783 | SRR037876(GSM522374) fibroblasts_cell_culture. (fibroblast) | SRR390725(GSM850204) small rna immunoprecipitated. (cell line) | SRR189782 | SRR037937(GSM510475) 293cand2. (cell line) | SRR033726(GSM497071) Mututated CLL (CLLM633). (B cell) | SRR039612(GSM531975) Human Normal Liver Tissue Sample 2. (liver) | GSM450603(GSM450603) miRNA sequencing raw reads from post-mortem s. (brain) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR037932(GSM510470) 293cand4_rep1. (cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR040006(GSM532891) G601N. (cervix) | SRR189786 | TAX577589(Rovira) total RNA. (breast) | SRR038863(GSM458546) MM603. (cell line) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | TAX577745(Rovira) total RNA. (breast) | SRR038852(GSM458535) QF1160MB. (cell line) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR033716(GSM497061) Mentle Cell Lymphoma (MCL114). (B cell) | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell) | SRR037941(GSM510479) 293DroshaTN. (cell line) | SRR015361(GSM380326) Memory B cells (MM55). (B cell) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR390723(GSM850202) total small RNA. (cell line) | SRR444047(SRX128895) Sample 27_1cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033731(GSM497076) h929 Cell line (h929). (B cell) | SRR553574(SRX182780) source: Heart. (Heart) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .........................................................................................................GTCTGGGTGGTGTAG.................................................................................................................................. | 15 | 3 | 22.67 | 22.67 | - | 4.67 | 3.00 | - | 3.00 | 1.00 | - | - | 0.33 | - | - | - | - | 0.67 | - | 1.33 | 1.33 | - | 0.67 | - | - | - | - | - | - | - | - | 0.67 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 0.33 | 0.67 | 0.33 | - | - | - | - | - | 0.33 | - | - | - | - | 0.33 | - | - | 0.33 | - | 0.33 | - | 0.33 | 0.33 | 0.33 | - | - | 0.33 | - | 0.33 | 0.33 | - | 0.33 |
| .........................................................................................................GTCTGGGTGGTGTAGTTGG.............................................................................................................................. | 19 | 3 | 9.67 | 22.67 | - | - | 0.67 | - | - | 1.00 | - | 0.67 | 2.00 | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | 0.33 | 0.67 | - | - | - | - | - | 0.33 | - | - | 0.33 | - | - | - | - | 0.33 | - | - | - | - | 0.33 | - | - | - | - | - | - |
| ....................................................................GGAGGAGGGCGGGCTGGGA................................................................................................................................................................... | 19 | 9.00 | 0.00 | 9.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................GTCTGGGTGGTGTAGTCGG.............................................................................................................................. | 19 | 3 | 6.00 | 22.67 | - | - | 0.33 | - | - | - | - | 0.33 | - | - | - | - | 1.00 | - | - | - | - | - | 0.67 | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | 0.67 | 0.33 | - | 0.67 | - | - | 0.33 | 0.33 | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - |
| ..........................................................................................................................................................................................CCTGGGCCGCACGCCCGC.............................................. | 18 | 4.00 | 0.00 | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................GTCTGGGTGGTGTAGT................................................................................................................................. | 16 | 3 | 3.33 | 22.67 | - | - | - | - | 0.33 | 0.33 | - | - | - | - | - | - | - | 0.33 | - | 0.33 | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | 0.33 | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - |
| .........................................................................................................GTCTGGGTGGTGTAGTTG............................................................................................................................... | 18 | 3 | 2.67 | 22.67 | - | - | 0.33 | - | - | - | - | 0.67 | - | - | - | - | - | - | 0.67 | - | - | 0.67 | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................GGGCGGGCTGCAGCCGGCGG............................................................................................................................................................ | 20 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................GTCTGGGTGGTGTAGA................................................................................................................................. | 16 | 3 | 2.00 | 22.67 | - | 1.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................GTCTGGGTGGTGTAGTC................................................................................................................................ | 17 | 3 | 1.33 | 22.67 | - | - | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - |
| .....................................................................GAGGAGGGCGGGCTGAGGA.................................................................................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................GGAGGAGGGCGGGCTGGGTA.................................................................................................................................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................................................GAGGGCCTGGGCCGCAAG................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................GCCTGCTGGGGAGGAACC............................................................................................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................AGGCTGGAGAGAAGGGACC.......................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................GAGAGAAGGAGTGTAAAAA.................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................CTGGGGAGGAGGGCGGGCTGC..................................................................................................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................AGGCTGGAGAGAAGGGGCG.......................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................GTCTGGGTGGTGTAGAA................................................................................................................................ | 17 | 3 | 1.00 | 22.67 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................................................................AAGGCGGGTTGGGAGGGCGA............................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................GGCGGGTTGGGAGGGGGA............................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................GTCTGGGTGGTGTAGTCG............................................................................................................................... | 18 | 3 | 1.00 | 22.67 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................GTGGCTGTGGGTCTGTGGG........................................................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................GCCTGCTGGGGAGGAACCT............................................................................................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................GGAGGAGGGCGGGCTGGCA................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................................................CCTGGGCCGCACGCCCG............................................... | 17 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................AGGCTGGAGAGAAGGGACG.......................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................GGGAGGAGGGCGGGCGAA..................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................TGGAGGCTGGAGAGAAAGTG............................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................GGGTCTGGGTGGTGTATGG................................................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................GTCTGGGTGGTGTAGC................................................................................................................................. | 16 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................GTCTGGGTGGTGTAGTT................................................................................................................................ | 17 | 3 | 0.33 | 22.67 | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| AGCAGCGCTTCAACATCATGTGCAACCACCTGAGGTTCAACCTGCCTCAGGTACCGCGGGCCTGCTGGGGAGGAGGGCGGGCTGCAGCCGTGCCTGTGGCTGTGGGTCTGGGTGGTGTAGCCTGGAGGCTGGAGAGAAGGAGTGTAAGGCTTGGGGGCGGGGCGTGCAGAAGGCGGGTTGGGAGGGCCTGGGCCGCACGCCCTGCTGAGCCAACCCCTGCCCCTCCAGGCGGCCAGTCGCCTGCCGTTGC .....................................................((((...(((.((....)).))))))).(((((((((......))))))))).((..(((......)))..))............................................................................................................................ ..................................................51...........................................................................128........................................................................................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR390724(GSM850203) small rna immunoprecipitated. (cell line) | SRR343334 | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR343335 | SRR189784 | SRR189787 | SRR189785 | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | GSM532876(GSM532876) G547T. (cervix) | SRR039615(GSM531978) Severe Chronic Hepatitis B Liver Tissue. (liver) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR015359(GSM380324) Germinal Center B cell (GC136). (B cell) | SRR444055(SRX128903) Sample 27_2cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR444062(SRX128910) Sample 27_3cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | SRR189783 | SRR037876(GSM522374) fibroblasts_cell_culture. (fibroblast) | SRR390725(GSM850204) small rna immunoprecipitated. (cell line) | SRR189782 | SRR037937(GSM510475) 293cand2. (cell line) | SRR033726(GSM497071) Mututated CLL (CLLM633). (B cell) | SRR039612(GSM531975) Human Normal Liver Tissue Sample 2. (liver) | GSM450603(GSM450603) miRNA sequencing raw reads from post-mortem s. (brain) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR037932(GSM510470) 293cand4_rep1. (cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR040006(GSM532891) G601N. (cervix) | SRR189786 | TAX577589(Rovira) total RNA. (breast) | SRR038863(GSM458546) MM603. (cell line) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | TAX577745(Rovira) total RNA. (breast) | SRR038852(GSM458535) QF1160MB. (cell line) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR033716(GSM497061) Mentle Cell Lymphoma (MCL114). (B cell) | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell) | SRR037941(GSM510479) 293DroshaTN. (cell line) | SRR015361(GSM380326) Memory B cells (MM55). (B cell) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR390723(GSM850202) total small RNA. (cell line) | SRR444047(SRX128895) Sample 27_1cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033731(GSM497076) h929 Cell line (h929). (B cell) | SRR553574(SRX182780) source: Heart. (Heart) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..................................GTTCAACCTGCCTCAAGTT..................................................................................................................................................................................................... | 19 | 3.00 | 0.00 | - | - | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................GCTGTGGGTCTGGGTTAAG..................................................................................................................................... | 19 | 2.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................................................GAAGGCGGGTTGGGAACT................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................GGCGGGCTGCAGCCGTGATT........................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................................................CGCACGCCCTGCTGAGCTCG..................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................GTTCAACCTGCCTCAGGGTT.................................................................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................GTTCAACCTGCCTCAA........................................................................................................................................................................................................ | 16 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........TTCAACATCATGTGCCAGC............................................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................................................................................GCCCCTCCAGGCGGCGGCG............. | 19 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................GTTCAACCTGCCTCAGACG..................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................GCCTCAGGTACCGCGGTAAC........................................................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................TGGGGAGGAGGGCGGACC....................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................CCAGGCTACACCACCCAGA............................................................................................................................. | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |