| (1) AGO2.ip | (3) B-CELL | (1) BRAIN | (12) BREAST | (30) CELL-LINE | (2) CERVIX | (1) FIBROBLAST | (3) HEART | (3) HELA | (1) KIDNEY | (8) LIVER | (1) OTHER | (26) SKIN | (1) TESTES |
| ATGCACTGGTTCCTGTGGCCCTTTCCTGCCTCTGGTCAAAAACGACCAAATGAATGAATAAAAGTCCCCTTTCTGCCAAAAATCTCCAGCAAGCTGCACAGATCTGATGTCCACATGATGAGCAGCCAGAGTCCAAGTTGGTCTGACTATTAAGACACTTGTTTGTGAAGTTCATGGATGTAAAGCTTGCTGCTTCTCAGTTCTCAGATATGTTGCTGTACACAAGCAAAGGAGTTGCAGGGACCAGCCA ..............................................................................................((.(((.......))).))..(((.(((((((..((((.(((((..((((........)))))))))((..((.....))..))......))))))))))).)))................................................... .............................................................................................94........................................................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR037940(GSM510478) 293cand5_rep2. (cell line) | SRR037937(GSM510475) 293cand2. (cell line) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | GSM359208(GSM359208) hepg2_bindASP_hl_2. (cell line) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR037939(GSM510477) 293cand5_rep1. (cell line) | SRR037933(GSM510471) 293cand4_rep2. (cell line) | SRR029125(GSM416754) U2OS. (cell line) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR037936(GSM510474) 293cand1. (cell line) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR039611(GSM531974) Human Normal Liver Tissue Sample 1. (liver) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR037931(GSM510469) 293GFP. (cell line) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR553576(SRX182782) source: Testis. (testes) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR191598(GSM715708) 79genomic small RNA (size selected RNA from t. (breast) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR029129(GSM416758) SW480. (cell line) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | GSM416733(GSM416733) HEK293. (cell line) | SRR189782 | SRR039612(GSM531975) Human Normal Liver Tissue Sample 2. (liver) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR037932(GSM510470) 293cand4_rep1. (cell line) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR037934(GSM510472) 293cand4_rep3. (cell line) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | SRR037935(GSM510473) 293cand3. (cell line) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR039614(GSM531977) HBV-infected Liver Tissue. (liver) | SRR040010(GSM532895) G529N. (cervix) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | SRR191603(GSM715713) 71genomic small RNA (size selected RNA from t. (breast) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR343332(GSM796035) "KSHV (HHV8), EBV (HHV-4)". (cell line) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR191612(GSM715722) 65genomic small RNA (size selected RNA from t. (breast) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM359192(GSM359192) HepG2_3pM_6. (cell line) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450609(GSM450609) miRNA sequencing raw reads from post-mortem s. (brain) | GSM1105753INPUT(GSM1105753) small RNA sequencing data. (hela) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR191593(GSM715703) 62genomic small RNA (size selected RNA from t. (breast) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver) | SRR029128(GSM416757) H520. (cell line) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | TAX577739(Rovira) total RNA. (breast) | GSM359204(GSM359204) HepG2_nucl_low. (cell line) | SRR038861(GSM458544) MM466. (cell line) | SRR363676(GSM830253) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | GSM956925Ago2D5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR191404(GSM715514) 47genomic small RNA (size selected RNA from t. (breast) | SRR038860(GSM458543) MM426. (cell line) | SRR038857(GSM458540) D20. (cell line) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR029132(GSM416761) MB-MDA231. (cell line) | SRR191635(GSM715745) 9genomic small RNA (size selected RNA from to. (breast) | SRR191422(GSM715532) 129genomic small RNA (size selected RNA from . (breast) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR191538(GSM715648) 49genomic small RNA (size selected RNA from t. (breast) | SRR040035(GSM532920) G001T. (cervix) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR191601(GSM715711) 58genomic small RNA (size selected RNA from t. (breast) | GSM956925Paz8D5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (cell line) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | GSM359190(GSM359190) HepG2_3pM_4. (cell line) | TAX577743(Rovira) total RNA. (breast) | SRR191413(GSM715523) 28genomic small RNA (size selected RNA from t. (breast) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..................................................................................................CAGATCTGATGTCCACATGATGAG................................................................................................................................ | 24 | 1 | 53.00 | 53.00 | - | - | 6.00 | 6.00 | - | - | 1.00 | - | 7.00 | - | 2.00 | 1.00 | 1.00 | 3.00 | - | 2.00 | 2.00 | - | - | - | - | 2.00 | - | - | 1.00 | - | 1.00 | - | 2.00 | - | - | 2.00 | - | 1.00 | 2.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | 1.00 | - | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - |
| ...................................................................................................AGATCTGATGTCCACATGATGAG................................................................................................................................ | 23 | 1 | 32.00 | 32.00 | - | 7.00 | - | - | 1.00 | 4.00 | 3.00 | 2.00 | - | 2.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | 2.00 | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 |
| ..................................................................................................CAGATCTGATGTCCACATGATGAGC............................................................................................................................... | 25 | 1 | 26.00 | 26.00 | - | - | - | - | - | - | - | 3.00 | - | - | - | 2.00 | 2.00 | - | 1.00 | - | 1.00 | 1.00 | - | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - |
| ...................................................................................................AGATCTGATGTCCACATGATGAGC............................................................................................................................... | 24 | 1 | 18.00 | 18.00 | 11.00 | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | 2.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................CAGATCTGATGTCCACATGATGAGCA.............................................................................................................................. | 26 | 1 | 14.00 | 14.00 | - | - | - | - | 2.00 | - | - | - | - | 3.00 | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - |
| .................................................................................................ACAGATCTGATGTCCACATGATGAG................................................................................................................................ | 25 | 1 | 9.00 | 9.00 | - | 4.00 | - | - | - | - | 3.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................TCCACATGATGAGCAGCCAGAGTCCAAGTTGGT............................................................................................................ | 33 | 1 | 5.00 | 5.00 | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - |
| ..................................................................................................CAGATCTGATGTCCACATGATGAGAA.............................................................................................................................. | 26 | 1 | 3.00 | 53.00 | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................TCTGATGTCCACATGATGAG................................................................................................................................ | 20 | 1 | 3.00 | 3.00 | 2.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................AGATCTGATGTCCACATGATG.................................................................................................................................. | 21 | 1 | 2.00 | 2.00 | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................CAGATCTGATGTCCACATGATGAGCAG............................................................................................................................. | 27 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................ACAGATCTGATGTCCACATGATGAGCA.............................................................................................................................. | 27 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................CAGATCTGATGTCCACATGATGAT................................................................................................................................ | 24 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................AGATCTGATGTCCACATGATGAGCA.............................................................................................................................. | 25 | 1 | 2.00 | 2.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................CCACATGATGAGCAGCCAGAGTCCAAGTTGGT............................................................................................................ | 32 | 1 | 2.00 | 2.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................TGAGCAGCCAGAGTCCAAGTTGGTCTGACT...................................................................................................... | 30 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................................................................................AGGAGTTGCAGGGACTC.... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................AGATCTGATGTCCACATGATGAT................................................................................................................................ | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................................CATGGATGTAAAGCTTGCTGCT........................................................ | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................ACAGATCTGATGTCCACATGATGAGC............................................................................................................................... | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................CAGATCTGATGTCCACATGATG.................................................................................................................................. | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................CAGATCTGATGTCCACATGATGCG................................................................................................................................ | 24 | 1 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................CAGATCTGATGTCCACATGAT................................................................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................CTGATGTCCACATGATGAGCAGAT........................................................................................................................... | 24 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................AGATCTGATGTCCACATGATGA................................................................................................................................. | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................GCAGCCAGAGTCCAAGTTGGTCTGACT...................................................................................................... | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................AGATCTGATGTCCACATGATA.................................................................................................................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................................................................................................TCTCAGATATGTTGCTGTACACAAGC....................... | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................CAGCCAGAGTCCAAGTTCTGC........................................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................TTGTGAAGTTCATGGATGTAAAGCTTGCTGC......................................................... | 31 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................TGATGTCCACATGATGAG................................................................................................................................ | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................TGATGTCCACATGATGAGC............................................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................AGTCCAAGTTGGTCTGACT...................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - |
| ........................................................................................................TGATGTCCACATGATGAGCA.............................................................................................................................. | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................AGATCTGATGTCCACATGAT................................................................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ATGCACTGGTTCCTGTGGCCCTTTCCTGCCTCTGGTCAAAAACGACCAAATGAATGAATAAAAGTCCCCTTTCTGCCAAAAATCTCCAGCAAGCTGCACAGATCTGATGTCCACATGATGAGCAGCCAGAGTCCAAGTTGGTCTGACTATTAAGACACTTGTTTGTGAAGTTCATGGATGTAAAGCTTGCTGCTTCTCAGTTCTCAGATATGTTGCTGTACACAAGCAAAGGAGTTGCAGGGACCAGCCA ..............................................................................................((.(((.......))).))..(((.(((((((..((((.(((((..((((........)))))))))((..((.....))..))......))))))))))).)))................................................... .............................................................................................94........................................................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR037940(GSM510478) 293cand5_rep2. (cell line) | SRR037937(GSM510475) 293cand2. (cell line) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | GSM359208(GSM359208) hepg2_bindASP_hl_2. (cell line) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR037939(GSM510477) 293cand5_rep1. (cell line) | SRR037933(GSM510471) 293cand4_rep2. (cell line) | SRR029125(GSM416754) U2OS. (cell line) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR037936(GSM510474) 293cand1. (cell line) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR039611(GSM531974) Human Normal Liver Tissue Sample 1. (liver) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR037931(GSM510469) 293GFP. (cell line) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR553576(SRX182782) source: Testis. (testes) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR191598(GSM715708) 79genomic small RNA (size selected RNA from t. (breast) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR029129(GSM416758) SW480. (cell line) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | GSM416733(GSM416733) HEK293. (cell line) | SRR189782 | SRR039612(GSM531975) Human Normal Liver Tissue Sample 2. (liver) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR037932(GSM510470) 293cand4_rep1. (cell line) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR037934(GSM510472) 293cand4_rep3. (cell line) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | SRR037935(GSM510473) 293cand3. (cell line) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR039614(GSM531977) HBV-infected Liver Tissue. (liver) | SRR040010(GSM532895) G529N. (cervix) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | SRR191603(GSM715713) 71genomic small RNA (size selected RNA from t. (breast) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR343332(GSM796035) "KSHV (HHV8), EBV (HHV-4)". (cell line) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR191612(GSM715722) 65genomic small RNA (size selected RNA from t. (breast) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM359192(GSM359192) HepG2_3pM_6. (cell line) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450609(GSM450609) miRNA sequencing raw reads from post-mortem s. (brain) | GSM1105753INPUT(GSM1105753) small RNA sequencing data. (hela) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR191593(GSM715703) 62genomic small RNA (size selected RNA from t. (breast) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver) | SRR029128(GSM416757) H520. (cell line) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | TAX577739(Rovira) total RNA. (breast) | GSM359204(GSM359204) HepG2_nucl_low. (cell line) | SRR038861(GSM458544) MM466. (cell line) | SRR363676(GSM830253) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | GSM956925Ago2D5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR191404(GSM715514) 47genomic small RNA (size selected RNA from t. (breast) | SRR038860(GSM458543) MM426. (cell line) | SRR038857(GSM458540) D20. (cell line) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR029132(GSM416761) MB-MDA231. (cell line) | SRR191635(GSM715745) 9genomic small RNA (size selected RNA from to. (breast) | SRR191422(GSM715532) 129genomic small RNA (size selected RNA from . (breast) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR191538(GSM715648) 49genomic small RNA (size selected RNA from t. (breast) | SRR040035(GSM532920) G001T. (cervix) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR191601(GSM715711) 58genomic small RNA (size selected RNA from t. (breast) | GSM956925Paz8D5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (cell line) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | GSM359190(GSM359190) HepG2_3pM_4. (cell line) | TAX577743(Rovira) total RNA. (breast) | SRR191413(GSM715523) 28genomic small RNA (size selected RNA from t. (breast) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ......................................................................................................................................................................GAAGTTCATGGATGTAAATTCC.............................................................. | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................TTTCTGCCAAAAATCTCCAT................................................................................................................................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................................TACAGCAACATATCTGAGAACTGAG.............................. | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................................AGCAACATATCTGAGAACTGAGAAGC................................. | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................................................ACATATCTGAGAACTGAGAAGCAGC..................................... | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....ACTGGTTCCTGTGGCACCA................................................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................................................GAGAACTGAGAAGCAGCAA............................................. | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................ATGAATAAAAGTCCCAGA................................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |