| (1) B-CELL | (2) BRAIN | (7) BREAST | (14) CELL-LINE | (11) CERVIX | (1) HEART | (1) LIVER | (2) OTHER | (22) SKIN |
| ACGTGCTAAGGCCACAGAGTGCCCAGGACCCGGTGTATCTTGGGAATGGCTGGGGTTGGCTGGTTGTTTCCCTTGAGGAGGGGGAGGTGCCCTTGCTGCCTCTGAGTCCCTTTGGCCCCGGCATCTCCTCCTTGAGTGTGCCCTTGGCACGTGATAGGTCAGGTCTCCCATCCATGCATGCCTCCCTCCTGTCCCTACAGTGCCCGCCACCAAGCTCAGCACACTGACGCGGCCCTGTCCGGGACCCTGC .............................................................................((((((((((((((......(((...(((...))).)))...))))))))))))))..................................................................................................................... ......................................................................71...............................................................136................................................................................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line) | SRR040039(GSM532924) G531T. (cervix) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR040036(GSM532921) G243N. (cervix) | SRR040031(GSM532916) G013T. (cervix) | TAX577741(Rovira) total RNA. (breast) | SRR037938(GSM510476) 293Red. (cell line) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577589(Rovira) total RNA. (breast) | TAX577744(Rovira) total RNA. (breast) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR037942(GSM510480) 293DroshaTN_cand5. (cell line) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR040040(GSM532925) G612N. (cervix) | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | TAX577580(Rovira) total RNA. (breast) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | TAX577588(Rovira) total RNA. (breast) | SRR444042(SRX128890) Sample 3cDNABarcode: AF-PP-335: ACG CTC TTC C. (skin) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040037(GSM532922) G243T. (cervix) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330882(SRX091720) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040016(GSM532901) G645N. (cervix) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR037943(GSM510481) 293DcrTN. (cell line) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR189782 | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR038858(GSM458541) MEL202. (cell line) | SRR037932(GSM510470) 293cand4_rep1. (cell line) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | GSM450610(GSM450610) miRNA sequencing raw reads from post-mortem s. (brain) | SRR037941(GSM510479) 293DroshaTN. (cell line) | SRR040038(GSM532923) G531N. (cervix) | SRR037940(GSM510478) 293cand5_rep2. (cell line) | TAX577579(Rovira) total RNA. (breast) | SRR029130(GSM416759) DLD2. (cell line) | SRR040012(GSM532897) G648N. (cervix) | SRR040032(GSM532917) G603N. (cervix) | SRR444054(SRX128902) Sample 14cDNABarcode: AF-PP-342: ACG CTC TTC . (skin) | SRR038862(GSM458545) MM472. (cell line) | GSM532886(GSM532886) G850T. (cervix) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577743(Rovira) total RNA. (breast) | SRR040015(GSM532900) G623T. (cervix) | SRR038852(GSM458535) QF1160MB. (cell line) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin) | SRR189775(GSM714635) cell line: HEK293clip variant: CLIPenzymatic . (cell line) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .................................................................................................................GGCCCCGGCATCTCCACCA...................................................................................................................... | 19 | 19.00 | 0.00 | 5.00 | - | - | - | - | 1.00 | 2.00 | - | - | 1.00 | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | 1.00 | - | - | - | 1.00 | - | 1.00 | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | |
| ..................................................................................................................GCCCCGGCATCTCCTCCA...................................................................................................................... | 18 | 6.00 | 0.00 | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................GGCCCCGGCATCTCCACCC...................................................................................................................... | 19 | 3.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | |
| ................................................................................................................TGGCCCCGGCATCTCCACCA...................................................................................................................... | 20 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................GCCCCGGCATCTCCTCCT...................................................................................................................... | 18 | 1 | 2.00 | 2.00 | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................GGCCCCGGCATCTCCCCCA...................................................................................................................... | 19 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................GGCCCCGGCATCTCCTCCA...................................................................................................................... | 19 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................GGCCCCGGCATCTCCAA........................................................................................................................ | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................GGCCCCGGCATCTCCACCG...................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................................................AAGCTCAGCACACTGACGCGGCCCT.............. | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................GCCCCGGCATCTCCTCCAA..................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................AGGAGGGGGAGGTGCAGGT............................................................................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................TTGCTGCCTCTGAGTCCCTTTGGCCCCGGC................................................................................................................................ | 30 | 1 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................CCCGGCATCTCCTCCATA.................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................................................................ACTGACGCGGCCCTGTC........... | 17 | 1 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................GGCCCCGGCATCTCCCCCG...................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................................................CCACCAAGCTCAGCACACTG........................ | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................CCTTGGCACGTGATAGGTCAGGTCT.................................................................................... | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................GCCCCGGCATCTCCTCCC...................................................................................................................... | 18 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................................................................................................CAGCACACTGACGCGGC................. | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................CCCCGGCATCTCCTCCT...................................................................................................................... | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................GCCCCGGCATCTCCTCCG...................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................GCCCCGGCATCTCCTCCAT..................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................GCCCCGGCATCTCCTGCG...................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................GGCCCCGGCATCTCCACTA...................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................................................................ACTGACGCGGCCCTGTCCGGGACC.... | 24 | 1 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................GCCCCGGCATCTCCTCCGC..................................................................................................................... | 19 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................................................CCACCAAGCTCAGCACACTGACG..................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................................................................CCCTGTCCGGGACCC... | 15 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 | - | - | - |
| .....................................................GGTTGGCTGGTTGTTT..................................................................................................................................................................................... | 16 | 9 | 0.11 | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 | - | - |
| ACGTGCTAAGGCCACAGAGTGCCCAGGACCCGGTGTATCTTGGGAATGGCTGGGGTTGGCTGGTTGTTTCCCTTGAGGAGGGGGAGGTGCCCTTGCTGCCTCTGAGTCCCTTTGGCCCCGGCATCTCCTCCTTGAGTGTGCCCTTGGCACGTGATAGGTCAGGTCTCCCATCCATGCATGCCTCCCTCCTGTCCCTACAGTGCCCGCCACCAAGCTCAGCACACTGACGCGGCCCTGTCCGGGACCCTGC .............................................................................((((((((((((((......(((...(((...))).)))...))))))))))))))..................................................................................................................... ......................................................................71...............................................................136................................................................................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line) | SRR040039(GSM532924) G531T. (cervix) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR040036(GSM532921) G243N. (cervix) | SRR040031(GSM532916) G013T. (cervix) | TAX577741(Rovira) total RNA. (breast) | SRR037938(GSM510476) 293Red. (cell line) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577589(Rovira) total RNA. (breast) | TAX577744(Rovira) total RNA. (breast) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR037942(GSM510480) 293DroshaTN_cand5. (cell line) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR040040(GSM532925) G612N. (cervix) | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | TAX577580(Rovira) total RNA. (breast) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | TAX577588(Rovira) total RNA. (breast) | SRR444042(SRX128890) Sample 3cDNABarcode: AF-PP-335: ACG CTC TTC C. (skin) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040037(GSM532922) G243T. (cervix) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330882(SRX091720) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040016(GSM532901) G645N. (cervix) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR037943(GSM510481) 293DcrTN. (cell line) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR189782 | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR038858(GSM458541) MEL202. (cell line) | SRR037932(GSM510470) 293cand4_rep1. (cell line) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | GSM450610(GSM450610) miRNA sequencing raw reads from post-mortem s. (brain) | SRR037941(GSM510479) 293DroshaTN. (cell line) | SRR040038(GSM532923) G531N. (cervix) | SRR037940(GSM510478) 293cand5_rep2. (cell line) | TAX577579(Rovira) total RNA. (breast) | SRR029130(GSM416759) DLD2. (cell line) | SRR040012(GSM532897) G648N. (cervix) | SRR040032(GSM532917) G603N. (cervix) | SRR444054(SRX128902) Sample 14cDNABarcode: AF-PP-342: ACG CTC TTC . (skin) | SRR038862(GSM458545) MM472. (cell line) | GSM532886(GSM532886) G850T. (cervix) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577743(Rovira) total RNA. (breast) | SRR040015(GSM532900) G623T. (cervix) | SRR038852(GSM458535) QF1160MB. (cell line) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin) | SRR189775(GSM714635) cell line: HEK293clip variant: CLIPenzymatic . (cell line) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...............................................................................................................................................................CAGGTCTCCCATCCAGG.......................................................................... | 17 | 5.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................................CAGGTCTCCCATCCAGGA......................................................................... | 18 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................GTCAGGTCTCCCATCACCA.......................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................................CAGGTCTCCCATCCACCTG........................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................TCAGGTCTCCCATCCAC........................................................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................TCAGGTCTCCCATCCAGGC......................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................TCAGGTCTCCCATCCAAC.......................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................AGGAGGAGATGCCGGGGC...................................................................................................................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................TCAGGTCTCCCATCCAACG......................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................................CAGGTCTCCCATCCACTG......................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................................CAGGTCTCCCATCCACT.......................................................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................GGTCTCCCATCCATGGC........................................................................ | 17 | 0.44 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 | - | - | - | 0.11 | 0.11 | |
| .................................................................................................................................................................GGTCTCCCATCCATGG......................................................................... | 16 | 0.22 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.22 | - | - | - | - | - | |
| .................................................................................................................................................................CATGGATGGGAGACC.......................................................................... | 15 | 9 | 0.22 | 0.22 | - | - | - | - | - | - | - | - | - | - | - | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 | - | - | - | - |
| .................................................................................................................................................................GCATGGATGGGAGACC......................................................................... | 16 | 5 | 0.20 | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - |
| .................................................................................................................................................................GGTCTCCCATCCATGGCC....................................................................... | 18 | 0.11 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 | - | - | - | - | |
| .................................................................................................................................................................GGTCTCCCATCCATGGCCT...................................................................... | 19 | 0.11 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |