ID: uc002ube.1_intron_10_0_chr2_160824190_r.5p
GENE: (19)
chr2:160825567-160825816-


(1)
AGO1.ip 		(1)
AGO1.ip OTHER.mut 		(5)
AGO2.ip 		(8)
B-CELL 		(14)
BRAIN 		(128)
BREAST 		(47)
CELL-LINE 		(18)
CERVIX 		(4)
FIBROBLAST 		(3)
HEART 		(6)
HELA 		(14)
LIVER 		(1)
OTHER 		(1)
OTHER.ip 		(1)
RRP40.ip 		(13)
SKIN 		(3)
UTERUS 		(1)
XRN.ip

Sense strand
AACTGTGAATAATCAGAGCCAGAGATGTGGCTTTATTTCTTCTATAACAGGTTATTTTACTTACCCATTTTTGGGTTTATAATACAAACTGATAATTTTCAGGAGGCTTAAAGTCTTTTCCTTGCATCATTTCCATGAGAAGTTTCTGTTTATTTCTCTTTTCAGTTGACGTGTTCAGTTTTGTCTGCCATAAGGCTTAAGGATGGCCATTTTTTTCTGTTCAATCCATGCATTCATGTTCTTGGAAATA
................................................................................(((((.((((((........(((((((.....))))))).................(((((((........)))))))...))))))...)))))...........................................................................
.......................................................................72.........................................................................................................179.....................................................................
SizePerfect hitTotal NormPerfect NormSRR189782GSM450608(GSM450608)
miRNA sequencing raw reads from post-mortem s. (brain)		SRR189787SRR037941(GSM510479)
293DroshaTN. (cell line)		SRR037943(GSM510481)
293DcrTN. (cell line)		SRR037938(GSM510476)
293Red. (cell line)		SRR037937(GSM510475)
293cand2. (cell line)		SRR039625(GSM531988)
HBV(-) HCV(-) HCC Tissue Sample. (liver)		GSM450603(GSM450603)
miRNA sequencing raw reads from post-mortem s. (brain)		GSM450609(GSM450609)
miRNA sequencing raw reads from post-mortem s. (brain)		GSM450600(GSM450600)
miRNA sequencing raw reads from post-mortem s. (brain)		SRR037944(GSM510482)
293DcrTN_cand5. (cell line)		GSM450606(GSM450606)
miRNA sequencing raw reads from post-mortem s. (brain)		GSM450598(GSM450598)
miRNA sequencing raw reads from post-mortem s. (brain)		SRR189786GSM450597(GSM450597)
miRNA sequencing raw reads from post-mortem s. (brain)		GSM450610(GSM450610)
miRNA sequencing raw reads from post-mortem s. (brain)		SRR037942(GSM510480)
293DroshaTN_cand5. (cell line)		GSM450601(GSM450601)
miRNA sequencing raw reads from post-mortem s. (brain)		GSM450605(GSM450605)
miRNA sequencing raw reads from post-mortem s. (brain)		GSM450607(GSM450607)
miRNA sequencing raw reads from post-mortem s. (brain)		GSM450604(GSM450604)
miRNA sequencing raw reads from post-mortem s. (brain)		SRR191434(GSM715544)
171genomic small RNA (size selected RNA from . (breast)		SRR387910(GSM843862)
antibody for ip: Ago2. (ago2 cell line)		GSM450599(GSM450599)
miRNA sequencing raw reads from post-mortem s. (brain)		SRR037939(GSM510477)
293cand5_rep1. (cell line)		SRR191406(GSM715516)
67genomic small RNA (size selected RNA from t. (breast)		GSM450602(GSM450602)
miRNA sequencing raw reads from post-mortem s. (brain)		SRR039621(GSM531984)
HBV(+) HCC Tissue Sample 2. (liver)		SRR039612(GSM531975)
Human Normal Liver Tissue Sample 2. (liver)		SRR039613(GSM531976)
Human Normal Liver Tissue Sample 3. (liver)		SRR037940(GSM510478)
293cand5_rep2. (cell line)		SRR191615(GSM715725)
94genomic small RNA (size selected RNA from t. (breast)		SRR191473(GSM715583)
121genomic small RNA (size selected RNA from . (breast)		SRR039624(GSM531987)
HBV(-) HCV(-) Adjacent Tissue Sample. (liver)		SRR191438(GSM715548)
175genomic small RNA (size selected RNA from . (breast)		SRR191422(GSM715532)
129genomic small RNA (size selected RNA from . (breast)		SRR039611(GSM531974)
Human Normal Liver Tissue Sample 1. (liver)		SRR191421(GSM715531)
122genomic small RNA (size selected RNA from . (breast)		SRR189784SRR191566(GSM715676)
94genomic small RNA (size selected RNA from t. (breast)		SRR015448(SRR015448)
cytoplasmic small RNAs. (breast)		TAX577743(Rovira)
total RNA. (breast)		SRR029125(GSM416754)
U2OS. (cell line)		SRR037935(GSM510473)
293cand3. (cell line)		SRR039620(GSM531983)
HBV(+) Adjacent Tissue Sample 2. (liver)		SRR039622(GSM531985)
HCV(+) Adjacent Tissue Sample. (liver)		SRR029131(GSM416760)
MCF7. (cell line)		SRR191479(GSM715589)
31genomic small RNA (size selected RNA from t. (breast)		SRR191420(GSM715530)
122genomic small RNA (size selected RNA from . (breast)		SRR191459(GSM715569)
32genomic small RNA (size selected RNA from t. (breast)		SRR191635(GSM715745)
9genomic small RNA (size selected RNA from to. (breast)		SRR191432(GSM715542)
169genomic small RNA (size selected RNA from . (breast)		SRR029124(GSM416753)
HeLa. (hela)		SRR094129(GSM651905)
small RNA(18-35nt)small RNA deep sequencing o. (uterus)		SRR037876(GSM522374)
fibroblasts_cell_culture. (fibroblast)		SRR207114(GSM721076)
"IP against AGO 1 & 2, RRP40 knockdown". (ago1/2 RRP40 cell line)		TAX577738(Rovira)
total RNA. (breast)		SRR191460(GSM715570)
33genomic small RNA (size selected RNA from t. (breast)		SRR039623(GSM531986)
HCV(+) HCC Tissue Sample. (liver)		SRR037933(GSM510471)
293cand4_rep2. (cell line)		SRR191622(GSM715732)
175genomic small RNA (size selected RNA from . (breast)		SRR191469(GSM715579)
117genomic small RNA (size selected RNA from . (breast)		SRR039615(GSM531978)
Severe Chronic Hepatitis B Liver Tissue. (liver)		SRR207113(GSM721075)
IP against AGO 1 & 2. (ago1/2 cell line)		SRR094131(GSM651907)
small RNA(18-35nt)small RNA deep sequencing o. (uterus)		SRR191439(GSM715549)
176genomic small RNA (size selected RNA from . (breast)		SRR039619(GSM531982)
HBV(+) HCC Tissue Sample 1. (liver)		SRR326280(GSM769510)
total cell content of unperturbed cells was s. (cell line)		SRR191436(GSM715546)
173genomic small RNA (size selected RNA from . (breast)		TAX577746(Rovira)
total RNA. (breast)		SRR191607(GSM715717)
192genomic small RNA (size selected RNA from . (breast)		SRR191465(GSM715575)
113genomic small RNA (size selected RNA from . (breast)		GSM532874(GSM532874)
G699T. (cervix)		SRR191452(GSM715562)
178genomic small RNA (size selected RNA from . (breast)		SRR191611(GSM715721)
57genomic small RNA (size selected RNA from t. (breast)		SRR191631(GSM715741)
75genomic small RNA (size selected RNA from t. (breast)		SRR191620(GSM715730)
167genomic small RNA (size selected RNA from . (breast)		SRR029127(GSM416756)
A549. (cell line)		SRR191456(GSM715566)
182genomic small RNA (size selected RNA from . (breast)		SRR191624(GSM715734)
31genomic small RNA (size selected RNA from t. (breast)		SRR191404(GSM715514)
47genomic small RNA (size selected RNA from t. (breast)		SRR037934(GSM510472)
293cand4_rep3. (cell line)		SRR039616(GSM531979)
HBV(+) Distal Tissue Sample 1. (liver)		SRR033722(GSM497067)
KMS12 cell line (KMS12). (B cell)		SRR191587(GSM715697)
50genomic small RNA (size selected RNA from t. (breast)		SRR039190(GSM494809)
PBMCs were isolated by ficoll gradient from t. (blood)		SRR207112(GSM721074)
RRP40 knockdown. (RRP40 cell line)		SRR191557(GSM715667)
57genomic small RNA (size selected RNA from t. (breast)		SRR191482(GSM715592)
5genomic small RNA (size selected RNA from to. (breast)		SRR191425(GSM715535)
141genomic small RNA (size selected RNA from . (breast)		SRR191621(GSM715731)
16genomic small RNA (size selected RNA from t. (breast)		SRR191629(GSM715739)
5genomic small RNA (size selected RNA from to. (breast)		SRR191481(GSM715591)
43genomic small RNA (size selected RNA from t. (breast)		SRR191442(GSM715552)
107genomic small RNA (size selected RNA from . (breast)		TAX577739(Rovira)
total RNA. (breast)		SRR015447(SRR015447)
nuclear small RNAs. (breast)		GSM1105749AGO2(GSM1105749)
small RNA sequencing data. (ago2 hela)		SRR191546(GSM715656)
152genomic small RNA (size selected RNA from . (breast)		SRR191559(GSM715669)
65genomic small RNA (size selected RNA from t. (breast)		SRR038861(GSM458544)
MM466. (cell line)		SRR330919(SRX091757)
tissue: normal skindisease state: normal. (skin)		SRR039193(GSM494812)
HL60 cell line is derived from acute promyelo. (cell line)		SRR191414(GSM715524)
31genomic small RNA (size selected RNA from t. (breast)		SRR191602(GSM715712)
60genomic small RNA (size selected RNA from t. (breast)		SRR191625(GSM715735)
32genomic small RNA (size selected RNA from t. (breast)		SRR191471(GSM715581)
119genomic small RNA (size selected RNA from . (breast)		SRR040024(GSM532909)
G613N. (cervix)		SRR191538(GSM715648)
49genomic small RNA (size selected RNA from t. (breast)		SRR191563(GSM715673)
83genomic small RNA (size selected RNA from t. (breast)		SRR191571(GSM715681)
63genomic small RNA (size selected RNA from t. (breast)		SRR191433(GSM715543)
170genomic small RNA (size selected RNA from . (breast)		TAX577579(Rovira)
total RNA. (breast)		SRR191410(GSM715520)
20genomic small RNA (size selected RNA from t. (breast)		SRR191409(GSM715519)
19genomic small RNA (size selected RNA from t. (breast)		SRR191412(GSM715522)
24genomic small RNA (size selected RNA from t. (breast)		SRR191605(GSM715715)
76genomic small RNA (size selected RNA from t. (breast)		SRR191451(GSM715561)
177genomic small RNA (size selected RNA from . (breast)		SRR040018(GSM532903)
G701N. (cervix)		SRR191477(GSM715587)
2genomic small RNA (size selected RNA from to. (breast)		GSM532878(GSM532878)
G691T. (cervix)		SRR037936(GSM510474)
293cand1. (cell line)		SRR040030(GSM532915)
G013N. (cervix)		TAX577580(Rovira)
total RNA. (breast)		DRR000561(DRX000319)
Isolation of RNA following immunoprecipitatio. (ago2 cell line)		TAX577588(Rovira)
total RNA. (breast)		SRR039614(GSM531977)
HBV-infected Liver Tissue. (liver)		SRR040010(GSM532895)
G529N. (cervix)		SRR191428(GSM715538)
160genomic small RNA (size selected RNA from . (breast)		SRR191603(GSM715713)
71genomic small RNA (size selected RNA from t. (breast)		SRR191470(GSM715580)
118genomic small RNA (size selected RNA from . (breast)		SRR191586(GSM715696)
197genomic small RNA (size selected RNA from . (breast)		SRR040028(GSM532913)
G026N. (cervix)		DRR000557(DRX000315)
"THP-1 whole cell RNA, after 3 day treatment . (cell line)		SRR191576(GSM715686)
86genomic small RNA (size selected RNA from t. (breast)		SRR191426(GSM715536)
149genomic small RNA (size selected RNA from . (breast)		GSM532871(GSM532871)
G652N. (cervix)		SRR191544(GSM715654)
126genomic small RNA (size selected RNA from . (breast)		SRR191612(GSM715722)
65genomic small RNA (size selected RNA from t. (breast)		SRR191466(GSM715576)
114genomic small RNA (size selected RNA from . (breast)		SRR191626(GSM715736)
36genomic small RNA (size selected RNA from t. (breast)		SRR191578(GSM715688)
100genomic small RNA (size selected RNA from . (breast)		SRR191541(GSM715651)
63genomic small RNA (size selected RNA from t. (breast)		SRR191570(GSM715680)
56genomic small RNA (size selected RNA from t. (breast)		SRR094132(GSM651908)
small RNA(18-35nt)small RNA deep sequencing o. (uterus)		TAX577741(Rovira)
total RNA. (breast)		SRR191597(GSM715707)
75genomic small RNA (size selected RNA from t. (breast)		SRR191483(GSM715593)
11genomic small RNA (size selected RNA from t. (breast)		SRR363676(GSM830253)
cell type: human foreskin fibroblasts (HFF)tr. (fibroblast)		DRR001489(DRX001043)
"Hela short nuclear cell fraction, control". (hela)		SRR191415(GSM715525)
33genomic small RNA (size selected RNA from t. (breast)		SRR444051(SRX128899)
Sample 11cDNABarcode: AF-PP-339: ACG CTC TTC . (skin)		SRR191564(GSM715674)
87genomic small RNA (size selected RNA from t. (breast)		SRR191474(GSM715584)
16genomic small RNA (size selected RNA from t. (breast)		SRR191609(GSM715719)
194genomic small RNA (size selected RNA from . (breast)		SRR191423(GSM715533)
137genomic small RNA (size selected RNA from . (breast)		SRR191461(GSM715571)
35genomic small RNA (size selected RNA from t. (breast)		SRR029132(GSM416761)
MB-MDA231. (cell line)		SRR107296(GSM677703)
18-30nt fraction of small RNA. (cell line)		SRR191443(GSM715553)
108genomic small RNA (size selected RNA from . (breast)		TAX577744(Rovira)
total RNA. (breast)		SRR191585(GSM715695)
196genomic small RNA (size selected RNA from . (breast)		SRR191445(GSM715555)
110genomic small RNA (size selected RNA from . (breast)		SRR191623(GSM715733)
18genomic small RNA (size selected RNA from t. (breast)		SRR191455(GSM715565)
181genomic small RNA (size selected RNA from . (breast)		GSM532886(GSM532886)
G850T. (cervix)		SRR363674(GSM830251)
cell type: human foreskin fibroblasts (HFF)tr. (fibroblast)		SRR191472(GSM715582)
120genomic small RNA (size selected RNA from . (breast)		TAX577745(Rovira)
total RNA. (breast)		SRR326281(GSM769511)
"Dicer mRNA was knocked down using siDicer, c. (cell line)		GSM532872(GSM532872)
G652T. (cervix)		SRR342899(SRX096795)
small RNA seq of Left atrial tissue. (heart)		SRR191464(GSM715574)
112genomic small RNA (size selected RNA from . (breast)		SRR029054(GSM402329)
MCF7_smallRNAseq. (cell line)		GSM532877(GSM532877)
G691N. (cervix)		SRR015446(SRR015446)
smallRNAs high-throughput sequencing Total. (breast)		SRR191598(GSM715708)
79genomic small RNA (size selected RNA from t. (breast)		SRR191478(GSM715588)
30genomic small RNA (size selected RNA from t. (breast)		SRR191628(GSM715738)
52genomic small RNA (size selected RNA from t. (breast)		SRR191397(GSM715507)
30genomic small RNA (size selected RNA from t. (breast)		DRR000555(DRX000313)
"THP-1 whole cell RNA, no treatment". (cell line)		GSM532876(GSM532876)
G547T. (cervix)		SRR191567(GSM715677)
46genomic small RNA (size selected RNA from t. (breast)		SRR191463(GSM715573)
111genomic small RNA (size selected RNA from . (breast)		SRR191462(GSM715572)
1genomic small RNA (size selected RNA from to. (breast)		SRR191441(GSM715551)
106genomic small RNA (size selected RNA from . (breast)		SRR191447(GSM715557)
142genomic small RNA (size selected RNA from . (breast)		SRR191499(GSM715609)
6genomic small RNA (size selected RNA from to. (breast)		SRR191633(GSM715743)
85genomic small RNA (size selected RNA from t. (breast)		SRR207111(GSM721073)
Whole cell RNA. (cell line)		SRR330907(SRX091745)
tissue: normal skindisease state: normal. (skin)		SRR444056(SRX128904)
Sample 28cDNABarcode: AF-PP-333: ACG CTC TTC . (skin)		SRR191457(GSM715567)
27genomic small RNA (size selected RNA from t. (breast)		GSM532883(GSM532883)
G871N. (cervix)		SRR191592(GSM715702)
59genomic small RNA (size selected RNA from t. (breast)		SRR189783SRR444059(SRX128907)
Sample 17cDNABarcode: AF-PP-339: ACG CTC TTC . (skin)		DRR000556(DRX000314)
"THP-1 whole cell RNA, after 3 day treatment . (cell line)		GSM532880(GSM532880)
G659T. (cervix)		SRR060985(GSM569189)
Human naive B cell [09-001]. (cell line)		SRR039618(GSM531981)
HBV(+) Side Tissue Sample 1. (liver)		SRR191454(GSM715564)
180genomic small RNA (size selected RNA from . (breast)		SRR342901(SRX096797)
small RNA seq of Left atrial tissue. (heart)		SRR191588(GSM715698)
52genomic small RNA (size selected RNA from t. (breast)		SRR191509(GSM715619)
156genomic small RNA (size selected RNA from . (breast)		SRR326279(GSM769509)
cytoplasmic fraction was isolated using PARIS. (cell line)		SRR033724(GSM497069)
L428 cell line (L428). (B cell)		GSM1105753INPUT(GSM1105753)
small RNA sequencing data. (hela)		DRR000558(DRX000316)
"THP-1 whole cell RNA, after 3 day treatment . (cell line)		SRR060984(GSM569188)
Human plasma cell [09-001]. (cell line)		SRR191556(GSM715666)
45genomic small RNA (size selected RNA from t. (breast)		SRR191475(GSM715585)
18genomic small RNA (size selected RNA from t. (breast)		SRR444049(SRX128897)
Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin)		SRR191565(GSM715675)
92genomic small RNA (size selected RNA from t. (breast)		SRR191449(GSM715559)
144genomic small RNA (size selected RNA from . (breast)		SRR191408(GSM715518)
88genomic small RNA (size selected RNA from t. (breast)		TAX577740(Rovira)
total RNA. (breast)		SRR191593(GSM715703)
62genomic small RNA (size selected RNA from t. (breast)		SRR330911(SRX091749)
tissue: normal skindisease state: normal. (skin)		SRR015364(GSM380329)
Plasma B cells (PC44). (B cell)		SRR189785SRR040031(GSM532916)
G013T. (cervix)		SRR033725(GSM497070)
Unmutated CLL (CLLU626). (B cell)		SRR191610(GSM715720)
195genomic small RNA (size selected RNA from . (breast)		SRR189779(GSM714639)
cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)		GSM1105751AGO4(GSM1105751)
small RNA sequencing data. (ago4 hela)		SRR040022(GSM532907)
G575N. (cervix)		SRR191416(GSM715526)
34genomic small RNA (size selected RNA from t. (breast)		TAX577590(Rovira)
total RNA. (breast)		SRR330871(SRX091709)
tissue: skin psoriatic involveddisease state:. (skin)		SRR444070(SRX128918)
Sample 27_4cDNABarcode: AF-PP-343: ACG CTC TT. (skin)		SRR191627(GSM715737)
45genomic small RNA (size selected RNA from t. (breast)		SRR191547(GSM715657)
155genomic small RNA (size selected RNA from . (breast)		SRR039635(GSM518472)
THP1_nuc_sRNAs. (cell line)		SRR191511(GSM715621)
161genomic small RNA (size selected RNA from . (breast)		SRR029126(GSM416755)
143B. (cell line)		SRR330874(SRX091712)
tissue: skin psoriatic involveddisease state:. (skin)		GSM956925Ago2D5(GSM956925)
"cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line)		DRR000559(DRX000317)
"THP-1 whole cell RNA, no treatment". (cell line)		SRR207115(GSM721077)
XRN1&2 knockdown. (XRN1/XRN2 cell line)		SRR029130(GSM416759)
DLD2. (cell line)		SRR191530(GSM715640)
132genomic small RNA (size selected RNA from . (breast)		GSM956925Ago2(GSM956925)
"cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line)		SRR191560(GSM715670)
77genomic small RNA (size selected RNA from t. (breast)		SRR330894(SRX091732)
tissue: skin psoriatic uninvolveddisease stat. (skin)		TAX577589(Rovira)
total RNA. (breast)		SRR191539(GSM715649)
61genomic small RNA (size selected RNA from t. (breast)		SRR191399(GSM715509)
36genomic small RNA (size selected RNA from t. (breast)		SRR033728(GSM497073)
MALT (MALT413). (B cell)		SRR363673(GSM830250)
cell type: human foreskin fibroblasts (HFF)tr. (fibroblast)		SRR207116(GSM721078)
Nuclear RNA. (cell line)		SRR060986(GSM569190)
Human memory B cell [09-001]. (cell line)		SRR189776(GSM714636)
cell line: HEK293clip variant: CLIPenzymatic . (cell line)		SRR330893(SRX091731)
tissue: skin psoriatic uninvolveddisease stat. (skin)		SRR342898(SRX096794)
small RNA seq of Right atrial tissue. (heart)		DRR001485(DRX001039)
"Hela long total cell fraction, LNA(+)". (hela)		SRR033723(GSM497068)
L1236 cell line (L1236). (B cell)		SRR191632(GSM715742)
78genomic small RNA (size selected RNA from t. (breast)		SRR330916(SRX091754)
tissue: normal skindisease state: normal. (skin)		SRR191430(GSM715540)
167genomic small RNA (size selected RNA from . (breast)		SRR033729(GSM497074)
splenic MZL (Splenic414). (B cell)		SRR033711(GSM497056)
GCB DLBCL (GCB110). (B cell)		SRR189777(GSM714637)
cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)		SRR040015(GSM532900)
G623T. (cervix)		SRR040039(GSM532924)
G531T. (cervix)
............................................................................TTATAATACAAACTGATAAGTG........................................................................................................................................................221799.0031.00224.0026.008.0022.0022.0017.0025.0022.009.0015.0018.008.0017.009.004.009.0010.005.0010.0013.008.0012.009.007.008.006.006.005.004.004.004.005.003.002.004.005.004.004.005.001.004.00-3.007.007.003.002.001.003.004.002.003.004.001.002.002.004.003.004.001.002.002.002.004.002.001.003.001.002.001.001.002.001.001.001.004.002.00-1.001.00-1.001.001.002.00-1.00--2.001.001.001.00--2.00-1.003.001.00-1.001.00---1.00-3.002.001.002.00--1.002.001.001.001.002.00-2.00--1.00---1.002.001.00-1.00-1.002.002.002.001.002.00--2.00-1.00-1.00-1.001.001.00-1.001.002.00--1.001.002.001.001.001.00-2.00-2.001.00--1.00--1.00-1.00-1.00-----1.00-1.001.001.001.00-1.00----------1.001.00------1.00---1.00-1.00-1.00-----1.00--1.00-1.00--1.00-----1.00---1.001.001.00-1.00--1.00----------1.00-1.00---
............................................................................TTATAATACAAACTGATAAGT.........................................................................................................................................................211725.0031.0027.0064.0018.0050.0042.0033.0016.0021.0030.0021.0019.0024.0016.0022.0017.0014.0010.0018.0012.0014.0012.009.006.0011.008.006.005.007.004.003.003.004.004.002.003.004.001.002.001.00-3.004.001.001.00-5.002.004.002.00-2.002.00-2.00-3.00-1.001.001.001.004.00--2.00-1.003.001.001.001.002.002.001.001.00-1.003.00-1.002.00-1.00-1.00---3.00-1.001.002.00-2.00-1.001.00-1.002.001.002.001.001.002.00-2.00--1.00-1.00-1.00-1.001.001.00-2.00----1.001.001.001.00--1.001.00-1.00---1.00-1.002.00-1.00--1.002.001.00--1.001.00----1.001.00-1.001.001.001.00----2.001.001.00-1.00---1.00--1.001.00---1.00------1.00-------1.00----1.00-1.001.00--1.00-1.00-----1.00--------------1.00-1.00--1.00-----------1.00----1.001.00---1.00----
............................................................................TTATAATACAAACTGATAAGTGT.......................................................................................................................................................231111.0031.005.00-6.0013.0016.0012.006.003.001.001.00-4.001.001.002.003.00-4.00----1.00--3.001.001.00---3.001.001.00--------1.00-1.00--------1.00------2.00-1.00-1.00---------1.00---1.00-----------1.00----------1.00--1.001.00------------------1.00--------1.00-----------1.00----------1.00-------------------------------------1.00--1.00------------------------------------1.00----1.00------1.00------------------
............................................................................TTATAATACAAACTGATAAG..........................................................................................................................................................201110.0031.0076.004.00--1.003.00-2.002.00-2.002.00----2.00-1.00---1.00--1.00--1.001.00-------1.00-1.00--------------1.00---------------1.00--------------1.00--------------1.00---------------------1.001.00---------1.00------1.00---------------------------------------------------------------------------------1.00------------------------------------------
............................................................................TTATAATACAAACTGATAAGTGA.......................................................................................................................................................23194.0031.002.003.003.001.00-2.004.005.00-1.001.001.00--1.007.005.001.00--2.001.001.001.001.001.001.00-2.003.002.00-2.001.002.00--2.002.00-1.001.00------2.00-2.002.00-----1.00-----1.00-1.001.00-2.002.00------1.00---1.00--1.00-------1.00-1.00-----1.00----1.00-------1.00----------1.00--------------------1.00----------2.00---------------1.00------1.00------------------------1.00----------------------------1.00---------------------1.00----------
............................................................................TTATAATACAAACTGATAAGCG........................................................................................................................................................22174.0031.0010.00-52.00-1.001.00---1.00----3.00----------------1.00---1.00-------------1.00---1.00-----------1.00-----------------------------------------------------------1.00-------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAA...........................................................................................................................................................19131.0031.007.00------3.00--------3.00-2.00---------2.001.00--1.00-1.00--1.00--------1.00-------1.00----2.00-----------------------1.00---2.00-----------------------------------------------------------------------------1.00-----------------------1.00----------1.00----------------------------------------------------------------
............................................................................TTATAATACAAACTGATAATTG........................................................................................................................................................22121.0010.007.00------1.00------------------2.00------1.00--1.00----------1.00--------1.00---1.00-1.00--1.00---------------------------1.00---------1.00---------1.00----------------1.00--------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAAGAG........................................................................................................................................................22120.0031.009.003.00---1.001.001.00-3.00---1.00----1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAAGGG........................................................................................................................................................22119.0031.001.001.00-1.00--2.00--------------------1.00--------1.00-----1.00----1.00------1.00-1.00--1.00------------------1.00---------------------------1.00--------------------------------------------------------------------------------------------------1.00--1.00----------------1.00--------------1.00----------1.00-------------
............................................................................TTATAATACAAACTGAAAAG..........................................................................................................................................................2017.000.0016.00-------------1.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAAGTA........................................................................................................................................................22115.0031.003.00-----1.00-------------1.00-1.00---1.00------1.001.00-1.001.00-----------------------------------------------------------------------1.00------------------------------------------------------------------------1.00----------1.00-----------------1.00-----------------------------------------------------
............................................................................TTATAATACAAACTGATAAGG.........................................................................................................................................................21115.0031.00-2.00-2.001.001.00--------------1.00-------------------1.00--------1.00-----------------------------1.00-1.00--------------------------------------------------------------------1.00-----------------------------------------------------------------1.00----1.00---------------------------1.00---------------
............................................................................TTATAATACAAACTGATAAGTT........................................................................................................................................................22115.0031.005.00-------1.001.00--1.001.00----1.00--1.00-----------1.00---------------------------------------------------1.001.00------------------------------------------------------------------------------1.00---------------------------------------------------------------------------------------------------
.............................................................................TATAATACAAACTGATAAGTG........................................................................................................................................................21112.002.00------2.002.00---------------------1.00--------1.00--2.00-----------------------------------1.00------------------1.00------------------------------------------------------------------1.00-------------------------------1.00---------------------------------------------------------------------
.............................................................................TATAATACAAACTGATAAGT.........................................................................................................................................................20112.002.00---1.00-------1.00----------------1.00-2.00----------2.00----1.00---1.00----------------1.00-----------------------------1.00-----------------------------------------------------------------------------------------------------------------------------------------------------1.00-----------------
............................................................................TTATAATACAAACTGATAAGA.........................................................................................................................................................21111.0031.001.001.001.001.001.00--2.001.00-----------1.00-------------------------------------------------------------------------1.00-------------------------------1.00------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAAGC.........................................................................................................................................................21110.0031.00--5.001.00--1.00-------1.00--------------------------------1.00----------------------------------------------------------1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAATT.........................................................................................................................................................21110.0010.001.00-----2.00-------1.00---1.00-----------------------1.00---------1.00------------------------------------------------------------------------------------------1.00---------1.00-------------------------------------------------------------------------------------------------------1.00-------
............................................................................TTATAATACAAACTGACAAG..........................................................................................................................................................209.000.002.00-3.00-----------1.00------------------------3.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAAGTC........................................................................................................................................................2219.0031.008.00----------------------------------------------------------------------------------------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAAATG........................................................................................................................................................2218.0031.005.00--1.00--------------1.00------------------------------1.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATTAG..........................................................................................................................................................2027.501.006.500.50-------------------0.50---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAAA..........................................................................................................................................................2017.0031.004.002.00-----------------------------------------------------------------------------------------------------------------------------------------------------1.00-----------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATA............................................................................................................................................................1817.007.002.00-------1.00---1.00--------------1.00-------------------------1.00---------------------------------1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................TATAATACAAACTGATAAGTGA.......................................................................................................................................................2216.002.00-------1.00--------------1.00---------------------------------------------------1.00-----1.00--------------------------------------------------------------------------------------1.00------------------------1.00------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAACCG........................................................................................................................................................2215.0031.001.00-3.00---------------------------------------------------------------------------1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAACT.........................................................................................................................................................2115.0031.001.00-1.00---2.00------------------------------------------------1.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................ATAATACAAACTGATAAGTG........................................................................................................................................................205.000.001.00---------------------------------------------------------1.00------1.00-------1.00-----------------------------------------------------------------------------------------------------------1.00-----------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAAGTAA.......................................................................................................................................................2314.0031.00-1.00--------------1.00-------------------------------------------------------1.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00-
............................................................................TTATAATACAAACTGATAATTA........................................................................................................................................................2214.0010.001.00-----------------------------------------------1.00--------------------------------------------1.00--------------------------------------------------------------1.00------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAAGCGA.......................................................................................................................................................2313.0031.00--2.00-------------------1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAAGGGT.......................................................................................................................................................2313.0031.00---1.00----------------------------1.00------------------------------------------------1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAAAT.........................................................................................................................................................2113.0031.00-----1.001.00-1.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.....................................................ATTTTACTTACCCATATAG..................................................................................................................................................................................193.000.00---------------------------------------2.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00--------------------------------------------
............................................................................TTATAATACAAACTGAATAG..........................................................................................................................................................203.000.003.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAACTG........................................................................................................................................................2213.0031.002.00------------------------------------------------------------------------------------------------------------------------------------------------1.00-----------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAATCG........................................................................................................................................................2213.001.002.00--------------------------------1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAAGCGT.......................................................................................................................................................2313.0031.00---1.002.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAATTGT.......................................................................................................................................................2313.0010.00-------------------------------------------1.00------------------------------------------------------------------1.00--------------------------------------------------------------------------------------------------------------------1.00-------------------------------------
............................................................................TTATAATACAAACTGATAAGGGA.......................................................................................................................................................2313.0031.00----------------------1.00-----------1.00--------------------------------------------------------------------1.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAGGT.........................................................................................................................................................2112.007.00-------1.00------1.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAAAA.........................................................................................................................................................2112.0031.00------------------------------1.00----------------------------------------------------------------------------------------------------1.00-------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAAGTGG.......................................................................................................................................................2312.0031.00-----1.00------1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................TATAATACAAACTGATAA...........................................................................................................................................................1812.002.00----------------------------------------------1.00-------1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................TATAATACAAACTGATAAG..........................................................................................................................................................1912.002.00----------------------------1.001.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAAGCC........................................................................................................................................................2212.0031.00--1.00--------------------------------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................TATAATACAAACTGATAAGGG........................................................................................................................................................2112.002.00------------------------------1.00---------------1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................ATAATACAAACTGATAAGT.........................................................................................................................................................192.000.00-----------------------------------------------------------------------------------------------------------------1.00------------------------------------------------------------------------------------1.00------------------------------------------------------------------
............................................................................TTATAATACAAACTGATATGT.........................................................................................................................................................2112.007.00----------------------------------------------------------------------------------1.00------------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................TATAATACAAACTGATAAGTT........................................................................................................................................................2112.002.00------------------------------------1.00-----1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATACGT.........................................................................................................................................................2112.007.00---------1.00-------------------------------------------------------------------------------------------------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAAACG........................................................................................................................................................2212.0031.001.00-1.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAAGCA........................................................................................................................................................2212.0031.001.00-1.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATACG..........................................................................................................................................................2012.007.001.001.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAATGA........................................................................................................................................................2212.001.00------------------------------------------1.00--------------------------------------1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAAGTTA.......................................................................................................................................................2312.0031.00------1.00--------------------1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATATGTT........................................................................................................................................................2212.007.001.00--------------------------------------------------------1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATCAGT.........................................................................................................................................................2121.501.00--0.50------0.50--------0.50------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................TATAATACAAACTGATAAATA........................................................................................................................................................2111.002.00-----------------------------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
........................ATGTGGCTTTATTTCTTCT...............................................................................................................................................................................................................1911.001.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00----------------------------
............................................................................TTATAATACAAACTGATAAATGT.......................................................................................................................................................2311.0031.00----1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
..........................................................................................................................................................TCTCTTTTCAGTTGACGTGTT...........................................................................2111.001.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00------
............................................................................TTATAATACAAACTGACTAG..........................................................................................................................................................201.000.00---------------------------------------1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAAAAA........................................................................................................................................................2211.0031.00-1.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.......................................................TTTACTTACCCATTTTGAG................................................................................................................................................................................191.000.00---------------------------------------1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAAGGGC.......................................................................................................................................................2311.0031.00-----1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATATGAG........................................................................................................................................................2211.007.00--------------------------------------------------------------------------------------1.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGAT.............................................................................................................................................................1721.001.00-0.50------0.50----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAGGTG........................................................................................................................................................2211.007.001.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAGGCG........................................................................................................................................................2211.007.00--------1.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAACGG........................................................................................................................................................2211.0031.00------1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATACGCG........................................................................................................................................................2211.007.00----------------------------------------------------------------------1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................GGCTTTATTTCTTCTGGA............................................................................................................................................................................................................181.000.00------1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAATGC........................................................................................................................................................2211.001.00--------------------------------------1.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................TAATACAAACTGATAAGTG........................................................................................................................................................191.000.00------------------------------------------------------------------------------------------------1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAATTTT.......................................................................................................................................................2311.001.00---------------------------------1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAAGTTT.......................................................................................................................................................2311.0031.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00--------------------------------------------------
..............................................ACAGGTTATTTTACTCTCC.........................................................................................................................................................................................191.000.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00--------------------------------------------------------------------
....GTGAATAATCAGAGCCAGAGATGTG.............................................................................................................................................................................................................................2511.001.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00--------------------
............................................................................TTATAATACAAACTGATAATTGA.......................................................................................................................................................2311.0010.00-----------------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
........................................................................................CTGATAATTTTCAGGGG.................................................................................................................................................171.000.00-----------------------------------------------------------------------------------------------------------------------------------------------------1.00-------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAAGTGC.......................................................................................................................................................2311.0031.00-1.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAGGC.........................................................................................................................................................2111.007.00-------1.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAAGGA........................................................................................................................................................2211.0031.00-------------------------------------------------------------------------------------1.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAAGTAT.......................................................................................................................................................2311.0031.00--------------------------------1.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
...................................................................................................................................................GTTTATTTCTCTTTTCCG.....................................................................................181.000.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00------------
............................................................................TTATAATACAAACTGATAATTT........................................................................................................................................................2211.001.00------1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................AATACAAACTGATAAGTG........................................................................................................................................................181.000.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATACTT.........................................................................................................................................................2111.007.00-------------------------------------------------------------------------------------------------------------------------------1.00-----------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATTAGT.........................................................................................................................................................2121.001.000.500.50-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................ATAATACAAACTGATAAGA.........................................................................................................................................................191.000.00-------------------------------------------------------------------------1.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATATTTG........................................................................................................................................................2211.007.00------------------------------------1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGTAA............................................................................................................................................................181.000.001.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
........................................................TTACTTACCCATTTTTTTTG..............................................................................................................................................................................201.000.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00--
..CTGTGAATAATCAGAGCCAGAGATGT..............................................................................................................................................................................................................................2611.001.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00-----------------------------------
............................................................................TTATAATACAAACTGATATGA.........................................................................................................................................................2111.007.00-1.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAAT..........................................................................................................................................................2011.001.001.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAAC..........................................................................................................................................................2011.0031.001.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAAAAG........................................................................................................................................................2211.0031.001.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAACGT........................................................................................................................................................2211.0031.00------------------------1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................TATAATACAAACTGATAAGTA........................................................................................................................................................2111.002.00-------------------------------------------------------------------------------1.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAATTAA.......................................................................................................................................................2311.0010.00---------------------------------1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................TATAATACAAACTGATAAGCG........................................................................................................................................................2111.002.00--1.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................ATAATACAAACTGATAAG..........................................................................................................................................................181.000.00----------1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATATTTT........................................................................................................................................................2211.007.00--------------------------------------------------------------1.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAACTTA.......................................................................................................................................................2311.0031.00------1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATACGC.........................................................................................................................................................2111.007.00----------------------------------------------------1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAAAGGA.......................................................................................................................................................2311.0031.00----------------1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
........................ATGTGGCTTTATTTCTCTGG..............................................................................................................................................................................................................201.000.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00----------------------------------------
................................................................................AATACAAACTGATAAGT.........................................................................................................................................................171.000.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00----------------------------------
.............................................................................TATAATACAAACTGATAAATG........................................................................................................................................................2111.002.00------------------------------------1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAATG.........................................................................................................................................................2111.001.00-1.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAAGGGG.......................................................................................................................................................2311.0031.00----------------------------------------------------------------------------------1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGAAAGC..........................................................................................................................................................201.000.00--------------1.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
...................CAGAGATGTGGCTTTCT......................................................................................................................................................................................................................171.000.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00---------------------------------------------
............................................................................TTATAATACAAACTGACAA...........................................................................................................................................................191.000.001.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATACTC.........................................................................................................................................................2111.007.00--------------------------------------------------------------------------------------------------------------------------1.00----------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAT...........................................................................................................................................................1911.007.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00-----------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAAATA........................................................................................................................................................2211.0031.00-1.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAACG.........................................................................................................................................................2111.0031.00-----------------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAACCGA.......................................................................................................................................................2311.0031.00--1.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATAAGTTC.......................................................................................................................................................2311.0031.001.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATTG...........................................................................................................................................................1920.501.00------------------------------0.50------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATCTTT.........................................................................................................................................................2120.501.00---------------------------------------------------------------------------------------------------------------0.50---------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATGACA.........................................................................................................................................................2120.501.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------0.50
............................................................................TTATAATACAAACTGATCAG..........................................................................................................................................................2020.501.00------------------0.50------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATCAGA.........................................................................................................................................................2120.501.000.50------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATG............................................................................................................................................................1820.501.00-0.50-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATTTG..........................................................................................................................................................2020.501.00--0.50----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATGAGT.........................................................................................................................................................2120.501.00----------------------------------------------------0.50--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................TTATAATACAAACTGATGTCG.........................................................................................................................................................2120.501.00----------------------------------------------------------------------------------------------------------------0.50--------------------------------------------------------------------------------------------------------------------------------------------------------

Antisense strand
AACTGTGAATAATCAGAGCCAGAGATGTGGCTTTATTTCTTCTATAACAGGTTATTTTACTTACCCATTTTTGGGTTTATAATACAAACTGATAATTTTCAGGAGGCTTAAAGTCTTTTCCTTGCATCATTTCCATGAGAAGTTTCTGTTTATTTCTCTTTTCAGTTGACGTGTTCAGTTTTGTCTGCCATAAGGCTTAAGGATGGCCATTTTTTTCTGTTCAATCCATGCATTCATGTTCTTGGAAATA
................................................................................(((((.((((((........(((((((.....))))))).................(((((((........)))))))...))))))...)))))...........................................................................
.......................................................................72.........................................................................................................179.....................................................................
SizePerfect hitTotal NormPerfect NormSRR189782GSM450608(GSM450608)
miRNA sequencing raw reads from post-mortem s. (brain)		SRR189787SRR037941(GSM510479)
293DroshaTN. (cell line)		SRR037943(GSM510481)
293DcrTN. (cell line)		SRR037938(GSM510476)
293Red. (cell line)		SRR037937(GSM510475)
293cand2. (cell line)		SRR039625(GSM531988)
HBV(-) HCV(-) HCC Tissue Sample. (liver)		GSM450603(GSM450603)
miRNA sequencing raw reads from post-mortem s. (brain)		GSM450609(GSM450609)
miRNA sequencing raw reads from post-mortem s. (brain)		GSM450600(GSM450600)
miRNA sequencing raw reads from post-mortem s. (brain)		SRR037944(GSM510482)
293DcrTN_cand5. (cell line)		GSM450606(GSM450606)
miRNA sequencing raw reads from post-mortem s. (brain)		GSM450598(GSM450598)
miRNA sequencing raw reads from post-mortem s. (brain)		SRR189786GSM450597(GSM450597)
miRNA sequencing raw reads from post-mortem s. (brain)		GSM450610(GSM450610)
miRNA sequencing raw reads from post-mortem s. (brain)		SRR037942(GSM510480)
293DroshaTN_cand5. (cell line)		GSM450601(GSM450601)
miRNA sequencing raw reads from post-mortem s. (brain)		GSM450605(GSM450605)
miRNA sequencing raw reads from post-mortem s. (brain)		GSM450607(GSM450607)
miRNA sequencing raw reads from post-mortem s. (brain)		GSM450604(GSM450604)
miRNA sequencing raw reads from post-mortem s. (brain)		SRR191434(GSM715544)
171genomic small RNA (size selected RNA from . (breast)		SRR387910(GSM843862)
antibody for ip: Ago2. (ago2 cell line)		GSM450599(GSM450599)
miRNA sequencing raw reads from post-mortem s. (brain)		SRR037939(GSM510477)
293cand5_rep1. (cell line)		SRR191406(GSM715516)
67genomic small RNA (size selected RNA from t. (breast)		GSM450602(GSM450602)
miRNA sequencing raw reads from post-mortem s. (brain)		SRR039621(GSM531984)
HBV(+) HCC Tissue Sample 2. (liver)		SRR039612(GSM531975)
Human Normal Liver Tissue Sample 2. (liver)		SRR039613(GSM531976)
Human Normal Liver Tissue Sample 3. (liver)		SRR037940(GSM510478)
293cand5_rep2. (cell line)		SRR191615(GSM715725)
94genomic small RNA (size selected RNA from t. (breast)		SRR191473(GSM715583)
121genomic small RNA (size selected RNA from . (breast)		SRR039624(GSM531987)
HBV(-) HCV(-) Adjacent Tissue Sample. (liver)		SRR191438(GSM715548)
175genomic small RNA (size selected RNA from . (breast)		SRR191422(GSM715532)
129genomic small RNA (size selected RNA from . (breast)		SRR039611(GSM531974)
Human Normal Liver Tissue Sample 1. (liver)		SRR191421(GSM715531)
122genomic small RNA (size selected RNA from . (breast)		SRR189784SRR191566(GSM715676)
94genomic small RNA (size selected RNA from t. (breast)		SRR015448(SRR015448)
cytoplasmic small RNAs. (breast)		TAX577743(Rovira)
total RNA. (breast)		SRR029125(GSM416754)
U2OS. (cell line)		SRR037935(GSM510473)
293cand3. (cell line)		SRR039620(GSM531983)
HBV(+) Adjacent Tissue Sample 2. (liver)		SRR039622(GSM531985)
HCV(+) Adjacent Tissue Sample. (liver)		SRR029131(GSM416760)
MCF7. (cell line)		SRR191479(GSM715589)
31genomic small RNA (size selected RNA from t. (breast)		SRR191420(GSM715530)
122genomic small RNA (size selected RNA from . (breast)		SRR191459(GSM715569)
32genomic small RNA (size selected RNA from t. (breast)		SRR191635(GSM715745)
9genomic small RNA (size selected RNA from to. (breast)		SRR191432(GSM715542)
169genomic small RNA (size selected RNA from . (breast)		SRR029124(GSM416753)
HeLa. (hela)		SRR094129(GSM651905)
small RNA(18-35nt)small RNA deep sequencing o. (uterus)		SRR037876(GSM522374)
fibroblasts_cell_culture. (fibroblast)		SRR207114(GSM721076)
"IP against AGO 1 & 2, RRP40 knockdown". (ago1/2 RRP40 cell line)		TAX577738(Rovira)
total RNA. (breast)		SRR191460(GSM715570)
33genomic small RNA (size selected RNA from t. (breast)		SRR039623(GSM531986)
HCV(+) HCC Tissue Sample. (liver)		SRR037933(GSM510471)
293cand4_rep2. (cell line)		SRR191622(GSM715732)
175genomic small RNA (size selected RNA from . (breast)		SRR191469(GSM715579)
117genomic small RNA (size selected RNA from . (breast)		SRR039615(GSM531978)
Severe Chronic Hepatitis B Liver Tissue. (liver)		SRR207113(GSM721075)
IP against AGO 1 & 2. (ago1/2 cell line)		SRR094131(GSM651907)
small RNA(18-35nt)small RNA deep sequencing o. (uterus)		SRR191439(GSM715549)
176genomic small RNA (size selected RNA from . (breast)		SRR039619(GSM531982)
HBV(+) HCC Tissue Sample 1. (liver)		SRR326280(GSM769510)
total cell content of unperturbed cells was s. (cell line)		SRR191436(GSM715546)
173genomic small RNA (size selected RNA from . (breast)		TAX577746(Rovira)
total RNA. (breast)		SRR191607(GSM715717)
192genomic small RNA (size selected RNA from . (breast)		SRR191465(GSM715575)
113genomic small RNA (size selected RNA from . (breast)		GSM532874(GSM532874)
G699T. (cervix)		SRR191452(GSM715562)
178genomic small RNA (size selected RNA from . (breast)		SRR191611(GSM715721)
57genomic small RNA (size selected RNA from t. (breast)		SRR191631(GSM715741)
75genomic small RNA (size selected RNA from t. (breast)		SRR191620(GSM715730)
167genomic small RNA (size selected RNA from . (breast)		SRR029127(GSM416756)
A549. (cell line)		SRR191456(GSM715566)
182genomic small RNA (size selected RNA from . (breast)		SRR191624(GSM715734)
31genomic small RNA (size selected RNA from t. (breast)		SRR191404(GSM715514)
47genomic small RNA (size selected RNA from t. (breast)		SRR037934(GSM510472)
293cand4_rep3. (cell line)		SRR039616(GSM531979)
HBV(+) Distal Tissue Sample 1. (liver)		SRR033722(GSM497067)
KMS12 cell line (KMS12). (B cell)		SRR191587(GSM715697)
50genomic small RNA (size selected RNA from t. (breast)		SRR039190(GSM494809)
PBMCs were isolated by ficoll gradient from t. (blood)		SRR207112(GSM721074)
RRP40 knockdown. (RRP40 cell line)		SRR191557(GSM715667)
57genomic small RNA (size selected RNA from t. (breast)		SRR191482(GSM715592)
5genomic small RNA (size selected RNA from to. (breast)		SRR191425(GSM715535)
141genomic small RNA (size selected RNA from . (breast)		SRR191621(GSM715731)
16genomic small RNA (size selected RNA from t. (breast)		SRR191629(GSM715739)
5genomic small RNA (size selected RNA from to. (breast)		SRR191481(GSM715591)
43genomic small RNA (size selected RNA from t. (breast)		SRR191442(GSM715552)
107genomic small RNA (size selected RNA from . (breast)		TAX577739(Rovira)
total RNA. (breast)		SRR015447(SRR015447)
nuclear small RNAs. (breast)		GSM1105749AGO2(GSM1105749)
small RNA sequencing data. (ago2 hela)		SRR191546(GSM715656)
152genomic small RNA (size selected RNA from . (breast)		SRR191559(GSM715669)
65genomic small RNA (size selected RNA from t. (breast)		SRR038861(GSM458544)
MM466. (cell line)		SRR330919(SRX091757)
tissue: normal skindisease state: normal. (skin)		SRR039193(GSM494812)
HL60 cell line is derived from acute promyelo. (cell line)		SRR191414(GSM715524)
31genomic small RNA (size selected RNA from t. (breast)		SRR191602(GSM715712)
60genomic small RNA (size selected RNA from t. (breast)		SRR191625(GSM715735)
32genomic small RNA (size selected RNA from t. (breast)		SRR191471(GSM715581)
119genomic small RNA (size selected RNA from . (breast)		SRR040024(GSM532909)
G613N. (cervix)		SRR191538(GSM715648)
49genomic small RNA (size selected RNA from t. (breast)		SRR191563(GSM715673)
83genomic small RNA (size selected RNA from t. (breast)		SRR191571(GSM715681)
63genomic small RNA (size selected RNA from t. (breast)		SRR191433(GSM715543)
170genomic small RNA (size selected RNA from . (breast)		TAX577579(Rovira)
total RNA. (breast)		SRR191410(GSM715520)
20genomic small RNA (size selected RNA from t. (breast)		SRR191409(GSM715519)
19genomic small RNA (size selected RNA from t. (breast)		SRR191412(GSM715522)
24genomic small RNA (size selected RNA from t. (breast)		SRR191605(GSM715715)
76genomic small RNA (size selected RNA from t. (breast)		SRR191451(GSM715561)
177genomic small RNA (size selected RNA from . (breast)		SRR040018(GSM532903)
G701N. (cervix)		SRR191477(GSM715587)
2genomic small RNA (size selected RNA from to. (breast)		GSM532878(GSM532878)
G691T. (cervix)		SRR037936(GSM510474)
293cand1. (cell line)		SRR040030(GSM532915)
G013N. (cervix)		TAX577580(Rovira)
total RNA. (breast)		DRR000561(DRX000319)
Isolation of RNA following immunoprecipitatio. (ago2 cell line)		TAX577588(Rovira)
total RNA. (breast)		SRR039614(GSM531977)
HBV-infected Liver Tissue. (liver)		SRR040010(GSM532895)
G529N. (cervix)		SRR191428(GSM715538)
160genomic small RNA (size selected RNA from . (breast)		SRR191603(GSM715713)
71genomic small RNA (size selected RNA from t. (breast)		SRR191470(GSM715580)
118genomic small RNA (size selected RNA from . (breast)		SRR191586(GSM715696)
197genomic small RNA (size selected RNA from . (breast)		SRR040028(GSM532913)
G026N. (cervix)		DRR000557(DRX000315)
"THP-1 whole cell RNA, after 3 day treatment . (cell line)		SRR191576(GSM715686)
86genomic small RNA (size selected RNA from t. (breast)		SRR191426(GSM715536)
149genomic small RNA (size selected RNA from . (breast)		GSM532871(GSM532871)
G652N. (cervix)		SRR191544(GSM715654)
126genomic small RNA (size selected RNA from . (breast)		SRR191612(GSM715722)
65genomic small RNA (size selected RNA from t. (breast)		SRR191466(GSM715576)
114genomic small RNA (size selected RNA from . (breast)		SRR191626(GSM715736)
36genomic small RNA (size selected RNA from t. (breast)		SRR191578(GSM715688)
100genomic small RNA (size selected RNA from . (breast)		SRR191541(GSM715651)
63genomic small RNA (size selected RNA from t. (breast)		SRR191570(GSM715680)
56genomic small RNA (size selected RNA from t. (breast)		SRR094132(GSM651908)
small RNA(18-35nt)small RNA deep sequencing o. (uterus)		TAX577741(Rovira)
total RNA. (breast)		SRR191597(GSM715707)
75genomic small RNA (size selected RNA from t. (breast)		SRR191483(GSM715593)
11genomic small RNA (size selected RNA from t. (breast)		SRR363676(GSM830253)
cell type: human foreskin fibroblasts (HFF)tr. (fibroblast)		DRR001489(DRX001043)
"Hela short nuclear cell fraction, control". (hela)		SRR191415(GSM715525)
33genomic small RNA (size selected RNA from t. (breast)		SRR444051(SRX128899)
Sample 11cDNABarcode: AF-PP-339: ACG CTC TTC . (skin)		SRR191564(GSM715674)
87genomic small RNA (size selected RNA from t. (breast)		SRR191474(GSM715584)
16genomic small RNA (size selected RNA from t. (breast)		SRR191609(GSM715719)
194genomic small RNA (size selected RNA from . (breast)		SRR191423(GSM715533)
137genomic small RNA (size selected RNA from . (breast)		SRR191461(GSM715571)
35genomic small RNA (size selected RNA from t. (breast)		SRR029132(GSM416761)
MB-MDA231. (cell line)		SRR107296(GSM677703)
18-30nt fraction of small RNA. (cell line)		SRR191443(GSM715553)
108genomic small RNA (size selected RNA from . (breast)		TAX577744(Rovira)
total RNA. (breast)		SRR191585(GSM715695)
196genomic small RNA (size selected RNA from . (breast)		SRR191445(GSM715555)
110genomic small RNA (size selected RNA from . (breast)		SRR191623(GSM715733)
18genomic small RNA (size selected RNA from t. (breast)		SRR191455(GSM715565)
181genomic small RNA (size selected RNA from . (breast)		GSM532886(GSM532886)
G850T. (cervix)		SRR363674(GSM830251)
cell type: human foreskin fibroblasts (HFF)tr. (fibroblast)		SRR191472(GSM715582)
120genomic small RNA (size selected RNA from . (breast)		TAX577745(Rovira)
total RNA. (breast)		SRR326281(GSM769511)
"Dicer mRNA was knocked down using siDicer, c. (cell line)		GSM532872(GSM532872)
G652T. (cervix)		SRR342899(SRX096795)
small RNA seq of Left atrial tissue. (heart)		SRR191464(GSM715574)
112genomic small RNA (size selected RNA from . (breast)		SRR029054(GSM402329)
MCF7_smallRNAseq. (cell line)		GSM532877(GSM532877)
G691N. (cervix)		SRR015446(SRR015446)
smallRNAs high-throughput sequencing Total. (breast)		SRR191598(GSM715708)
79genomic small RNA (size selected RNA from t. (breast)		SRR191478(GSM715588)
30genomic small RNA (size selected RNA from t. (breast)		SRR191628(GSM715738)
52genomic small RNA (size selected RNA from t. (breast)		SRR191397(GSM715507)
30genomic small RNA (size selected RNA from t. (breast)		DRR000555(DRX000313)
"THP-1 whole cell RNA, no treatment". (cell line)		GSM532876(GSM532876)
G547T. (cervix)		SRR191567(GSM715677)
46genomic small RNA (size selected RNA from t. (breast)		SRR191463(GSM715573)
111genomic small RNA (size selected RNA from . (breast)		SRR191462(GSM715572)
1genomic small RNA (size selected RNA from to. (breast)		SRR191441(GSM715551)
106genomic small RNA (size selected RNA from . (breast)		SRR191447(GSM715557)
142genomic small RNA (size selected RNA from . (breast)		SRR191499(GSM715609)
6genomic small RNA (size selected RNA from to. (breast)		SRR191633(GSM715743)
85genomic small RNA (size selected RNA from t. (breast)		SRR207111(GSM721073)
Whole cell RNA. (cell line)		SRR330907(SRX091745)
tissue: normal skindisease state: normal. (skin)		SRR444056(SRX128904)
Sample 28cDNABarcode: AF-PP-333: ACG CTC TTC . (skin)		SRR191457(GSM715567)
27genomic small RNA (size selected RNA from t. (breast)		GSM532883(GSM532883)
G871N. (cervix)		SRR191592(GSM715702)
59genomic small RNA (size selected RNA from t. (breast)		SRR189783SRR444059(SRX128907)
Sample 17cDNABarcode: AF-PP-339: ACG CTC TTC . (skin)		DRR000556(DRX000314)
"THP-1 whole cell RNA, after 3 day treatment . (cell line)		GSM532880(GSM532880)
G659T. (cervix)		SRR060985(GSM569189)
Human naive B cell [09-001]. (cell line)		SRR039618(GSM531981)
HBV(+) Side Tissue Sample 1. (liver)		SRR191454(GSM715564)
180genomic small RNA (size selected RNA from . (breast)		SRR342901(SRX096797)
small RNA seq of Left atrial tissue. (heart)		SRR191588(GSM715698)
52genomic small RNA (size selected RNA from t. (breast)		SRR191509(GSM715619)
156genomic small RNA (size selected RNA from . (breast)		SRR326279(GSM769509)
cytoplasmic fraction was isolated using PARIS. (cell line)		SRR033724(GSM497069)
L428 cell line (L428). (B cell)		GSM1105753INPUT(GSM1105753)
small RNA sequencing data. (hela)		DRR000558(DRX000316)
"THP-1 whole cell RNA, after 3 day treatment . (cell line)		SRR060984(GSM569188)
Human plasma cell [09-001]. (cell line)		SRR191556(GSM715666)
45genomic small RNA (size selected RNA from t. (breast)		SRR191475(GSM715585)
18genomic small RNA (size selected RNA from t. (breast)		SRR444049(SRX128897)
Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin)		SRR191565(GSM715675)
92genomic small RNA (size selected RNA from t. (breast)		SRR191449(GSM715559)
144genomic small RNA (size selected RNA from . (breast)		SRR191408(GSM715518)
88genomic small RNA (size selected RNA from t. (breast)		TAX577740(Rovira)
total RNA. (breast)		SRR191593(GSM715703)
62genomic small RNA (size selected RNA from t. (breast)		SRR330911(SRX091749)
tissue: normal skindisease state: normal. (skin)		SRR015364(GSM380329)
Plasma B cells (PC44). (B cell)		SRR189785SRR040031(GSM532916)
G013T. (cervix)		SRR033725(GSM497070)
Unmutated CLL (CLLU626). (B cell)		SRR191610(GSM715720)
195genomic small RNA (size selected RNA from . (breast)		SRR189779(GSM714639)
cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)		GSM1105751AGO4(GSM1105751)
small RNA sequencing data. (ago4 hela)		SRR040022(GSM532907)
G575N. (cervix)		SRR191416(GSM715526)
34genomic small RNA (size selected RNA from t. (breast)		TAX577590(Rovira)
total RNA. (breast)		SRR330871(SRX091709)
tissue: skin psoriatic involveddisease state:. (skin)		SRR444070(SRX128918)
Sample 27_4cDNABarcode: AF-PP-343: ACG CTC TT. (skin)		SRR191627(GSM715737)
45genomic small RNA (size selected RNA from t. (breast)		SRR191547(GSM715657)
155genomic small RNA (size selected RNA from . (breast)		SRR039635(GSM518472)
THP1_nuc_sRNAs. (cell line)		SRR191511(GSM715621)
161genomic small RNA (size selected RNA from . (breast)		SRR029126(GSM416755)
143B. (cell line)		SRR330874(SRX091712)
tissue: skin psoriatic involveddisease state:. (skin)		GSM956925Ago2D5(GSM956925)
"cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line)		DRR000559(DRX000317)
"THP-1 whole cell RNA, no treatment". (cell line)		SRR207115(GSM721077)
XRN1&2 knockdown. (XRN1/XRN2 cell line)		SRR029130(GSM416759)
DLD2. (cell line)		SRR191530(GSM715640)
132genomic small RNA (size selected RNA from . (breast)		GSM956925Ago2(GSM956925)
"cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line)		SRR191560(GSM715670)
77genomic small RNA (size selected RNA from t. (breast)		SRR330894(SRX091732)
tissue: skin psoriatic uninvolveddisease stat. (skin)		TAX577589(Rovira)
total RNA. (breast)		SRR191539(GSM715649)
61genomic small RNA (size selected RNA from t. (breast)		SRR191399(GSM715509)
36genomic small RNA (size selected RNA from t. (breast)		SRR033728(GSM497073)
MALT (MALT413). (B cell)		SRR363673(GSM830250)
cell type: human foreskin fibroblasts (HFF)tr. (fibroblast)		SRR207116(GSM721078)
Nuclear RNA. (cell line)		SRR060986(GSM569190)
Human memory B cell [09-001]. (cell line)		SRR189776(GSM714636)
cell line: HEK293clip variant: CLIPenzymatic . (cell line)		SRR330893(SRX091731)
tissue: skin psoriatic uninvolveddisease stat. (skin)		SRR342898(SRX096794)
small RNA seq of Right atrial tissue. (heart)		DRR001485(DRX001039)
"Hela long total cell fraction, LNA(+)". (hela)		SRR033723(GSM497068)
L1236 cell line (L1236). (B cell)		SRR191632(GSM715742)
78genomic small RNA (size selected RNA from t. (breast)		SRR330916(SRX091754)
tissue: normal skindisease state: normal. (skin)		SRR191430(GSM715540)
167genomic small RNA (size selected RNA from . (breast)		SRR033729(GSM497074)
splenic MZL (Splenic414). (B cell)		SRR033711(GSM497056)
GCB DLBCL (GCB110). (B cell)		SRR189777(GSM714637)
cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)		SRR040015(GSM532900)
G623T. (cervix)		SRR040039(GSM532924)
G531T. (cervix)
.....................................................................................................................................CATGAGAAGTTTCTGTTG................................................................................................... 182.000.002.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................................................................TCTGTTTATTTCTCTTTTGGTA.................................................................................... 221.000.00-----------------------------------------------------------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------