| (1) B-CELL | (1) BRAIN | (8) BREAST | (12) CELL-LINE | (3) CERVIX | (1) FIBROBLAST | (7) HEART | (1) HELA | (2) LIVER | (1) OTHER | (39) SKIN | (1) TESTES | (1) UTERUS |
| CTGTGAGCCAGCAGCTCCCCCATCCGCCCTCCCCATGTCAGCCACCTACTGTGTGGGAGATGCTGCCAGGCAGGGCCTCAGGAGGACACCCCTGGGTCATGGCTCCCCAGACACCTCAGAGACACCCCAGAATCCTAAGGGCAGCAGTCGGGTACTCTGCCTCCGGGAAGTGGGTGCCAGGTTCGTCTCCTGCCTTCTAGGTGAGCAGCTATTCCTGGAGCCAGAGCTGGTCATCCCCCACCGCCAGCAC ......................................................................................................................................((((((((((.((.(((((((((..((....))....))))))).....)).)).))))))).))).................................................. ..................................................................................................................................131..................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR095854(SRX039177) "miRNA were isolated from FirstChoice Human B. (brain) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | GSM1105753INPUT(GSM1105753) small RNA sequencing data. (hela) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR189784 | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR191613(GSM715723) 66genomic small RNA (size selected RNA from t. (breast) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189782 | SRR553576(SRX182782) source: Testis. (testes) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR040010(GSM532895) G529N. (cervix) | SRR189787 | SRR191630(GSM715740) 70genomic small RNA (size selected RNA from t. (breast) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR037937(GSM510475) 293cand2. (cell line) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR191631(GSM715741) 75genomic small RNA (size selected RNA from t. (breast) | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191626(GSM715736) 36genomic small RNA (size selected RNA from t. (breast) | SRR330875(SRX091713) tissue: skin psoriatic involveddisease state:. (skin) | SRR191580(GSM715690) 103genomic small RNA (size selected RNA from . (breast) | SRR363676(GSM830253) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR343335 | SRR040012(GSM532897) G648N. (cervix) | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR038863(GSM458546) MM603. (cell line) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191579(GSM715689) 102genomic small RNA (size selected RNA from . (breast) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | SRR191550(GSM715660) 27genomic small RNA (size selected RNA from t. (breast) | SRR191571(GSM715681) 63genomic small RNA (size selected RNA from t. (breast) | SRR444052(SRX128900) Sample 12cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR343332(GSM796035) "KSHV (HHV8), EBV (HHV-4)". (cell line) | SRR343336 | SRR040008(GSM532893) G727N. (cervix) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR038859(GSM458542) MM386. (cell line) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR343337 | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ................................................................................................................................................................................CCAGGTTCGTCTCCTGGC........................................................ | 18 | 1 | 44.00 | 2.00 | - | 2.00 | 1.00 | 6.00 | - | 4.00 | 1.00 | 1.00 | 2.00 | 3.00 | - | 2.00 | 1.00 | - | - | - | 2.00 | 1.00 | 2.00 | - | 2.00 | 1.00 | - | - | - | - | - | - | 2.00 | 1.00 | - | - | 2.00 | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................CAGGTTCGTCTCCTGGC........................................................ | 17 | 1 | 35.00 | 3.00 | 4.00 | 3.00 | - | - | 4.00 | 1.00 | 1.00 | 1.00 | - | 1.00 | - | - | - | 2.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | 1.00 | 2.00 | - | 1.00 | - | - | - | - | 1.00 | 2.00 | 1.00 | - | - | - | - | - | 1.00 | - | 1.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................CAGGTTCGTCTCCTGG......................................................... | 16 | 1 | 21.00 | 3.00 | 3.00 | - | 1.00 | - | 2.00 | - | 1.00 | - | 1.00 | - | 2.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................CCAGGTTCGTCTCCTGGCTG...................................................... | 20 | 1 | 10.00 | 2.00 | - | 1.00 | 3.00 | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................CAGGTTCGTCTCCTGGCT....................................................... | 18 | 1 | 7.00 | 3.00 | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................CCAGGTTCGTCTCCTGGCT....................................................... | 19 | 1 | 5.00 | 2.00 | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................CAGGTTCGTCTCCTGGCTG...................................................... | 19 | 1 | 4.00 | 3.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................TAAGGGCAGCAGTCGGGTACCCTG........................................................................................... | 24 | 3.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................................CAGGTTCGTCTCCTG.......................................................... | 15 | 1 | 3.00 | 3.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................CCAGGTTCGTCTCCTG.......................................................... | 16 | 1 | 2.00 | 2.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................AAGGGCAGCAGTCGGGTACTCTG........................................................................................... | 23 | 2 | 1.50 | 1.50 | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................AAGGGCAGCAGTCGGGTACTCTGA.......................................................................................... | 24 | 2 | 1.00 | 1.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................................................TGGAGCCAGAGCTGGTAC................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................GTGTGGGAGATGCTGGT....................................................................................................................................................................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................................TACTCTGCCTCCGGGAAGT............................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................AAGGGCAGCAGTCGGGTACTCT............................................................................................ | 22 | 2 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - |
| ...................................................................................................................................................................................GGTTCGTCTCCTGCC........................................................ | 15 | 2 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | 0.50 | - |
| ...........................................................................................................................ACCCCAGAATCCTAACTTT............................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................AAGGGCAGCAGTCGGGTACT.............................................................................................. | 20 | 2 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - |
| .......................................................................................................................................TAAGGGCAGCAGTCGGGTACTCTG........................................................................................... | 24 | 2 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................GCCTCCGGGAAGTGGGCGA......................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................................AGGTGAGCAGCTATTCCTGGAGCCAGAGCAGG.................... | 32 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................AAGGGCAGCAGTCGGGTACTCTGT.......................................................................................... | 24 | 2 | 1.00 | 1.50 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................CCAGGTTCGTCTCCTGG......................................................... | 17 | 1 | 1.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................TAAGGGCAGCAGTCGGGTACTCTGA.......................................................................................... | 25 | 2 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................GAGACACCCCAGAATC.................................................................................................................... | 16 | 3 | 0.67 | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.67 | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................GGTTCGTCTCCTGCCG....................................................... | 16 | 2 | 0.50 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................................................................AGCCAGAGCTGGTCATCCCCC........... | 21 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - |
| ......................................................................................................................................CTAAGGGCAGCAGTCGGGTACTCTG........................................................................................... | 25 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................................CTTCTAGGTGAGCAGCTAT...................................... | 19 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................AAGGGCAGCAGTCGGGTACTCTGCC......................................................................................... | 25 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................CCAGGTTCGTCTCCT........................................................... | 15 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................CCAGGTTCGTCTCCTAGCT....................................................... | 19 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................AATCCTAAGGGCAGCAGTCG.................................................................................................... | 20 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................TAAGGGCAGCAGTCGGGTACTC............................................................................................. | 22 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - |
| ......................................................................................................................................................................................................................CTGGAGCCAGAGCTGGTCATCCCCCACCGCCAGCA. | 35 | 2 | 0.50 | 0.50 | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................GGTTCGTCTCCTGCCT....................................................... | 16 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - |
| ..................................................................................................................................................GTCGGGTACTCTGCC......................................................................................... | 15 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 |
| .......................................................................................................................................................................................CGTCTCCTGCCTTCT.................................................... | 15 | 9 | 0.11 | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| CTGTGAGCCAGCAGCTCCCCCATCCGCCCTCCCCATGTCAGCCACCTACTGTGTGGGAGATGCTGCCAGGCAGGGCCTCAGGAGGACACCCCTGGGTCATGGCTCCCCAGACACCTCAGAGACACCCCAGAATCCTAAGGGCAGCAGTCGGGTACTCTGCCTCCGGGAAGTGGGTGCCAGGTTCGTCTCCTGCCTTCTAGGTGAGCAGCTATTCCTGGAGCCAGAGCTGGTCATCCCCCACCGCCAGCAC ......................................................................................................................................((((((((((.((.(((((((((..((....))....))))))).....)).)).))))))).))).................................................. ..................................................................................................................................131..................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR095854(SRX039177) "miRNA were isolated from FirstChoice Human B. (brain) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | GSM1105753INPUT(GSM1105753) small RNA sequencing data. (hela) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR189784 | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR191613(GSM715723) 66genomic small RNA (size selected RNA from t. (breast) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189782 | SRR553576(SRX182782) source: Testis. (testes) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR040010(GSM532895) G529N. (cervix) | SRR189787 | SRR191630(GSM715740) 70genomic small RNA (size selected RNA from t. (breast) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR037937(GSM510475) 293cand2. (cell line) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR191631(GSM715741) 75genomic small RNA (size selected RNA from t. (breast) | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191626(GSM715736) 36genomic small RNA (size selected RNA from t. (breast) | SRR330875(SRX091713) tissue: skin psoriatic involveddisease state:. (skin) | SRR191580(GSM715690) 103genomic small RNA (size selected RNA from . (breast) | SRR363676(GSM830253) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR343335 | SRR040012(GSM532897) G648N. (cervix) | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR038863(GSM458546) MM603. (cell line) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191579(GSM715689) 102genomic small RNA (size selected RNA from . (breast) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | SRR191550(GSM715660) 27genomic small RNA (size selected RNA from t. (breast) | SRR191571(GSM715681) 63genomic small RNA (size selected RNA from t. (breast) | SRR444052(SRX128900) Sample 12cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR343332(GSM796035) "KSHV (HHV8), EBV (HHV-4)". (cell line) | SRR343336 | SRR040008(GSM532893) G727N. (cervix) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR038859(GSM458542) MM386. (cell line) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR343337 | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .............................................................................................................................................CAGCAGTCGGGTACTCTAGAA........................................................................................ | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................................................................CATCCCCCACCGCCAGGTT | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................ATCCGCCCTCCCCATAGTC.................................................................................................................................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......GCCAGCAGCTCCCCCAGTTG................................................................................................................................................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................TAGGATTCTGGGGTGTCTCTGAGGT................................................................................................................. | 25 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |