| (17) B-CELL | (5) BRAIN | (9) CELL-LINE | (1) CERVIX | (2) HEART | (2) HELA | (2) LIVER | (2) OTHER | (12) SKIN | (1) UTERUS |
| CAACAGGAAAGTCTAAGGGATATGGCTTTGTCTCCTTTTTCAACAAATGGGTGAGCTCAGTGAGAAGTGCATGGATAATGCTTAAAGAGTAAAGAATGGAAACACTCCGTTTTAATTACTAATCTTTTTTTCGTCTGCTGTTTATTTTACTGATGATTAAAATAAACCCTCACTAGAAGATTTCTTCTGTTTTGTCTGTTTAACATTTATTGGCACCTGAGGCATGCAGAGTACTGATAAGATGTTTTCA ...............................................((((....))))..((((((.((((.....))))......(((((((((((((.....))))))))..)))))......))))))...................................................................................................................... ............................................45.......................................................................................134.................................................................................................................. | Size | Perfect hit | Total Norm | Perfect Norm | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR015358(GSM380323) NaÌøve B Cell (Naive39). (B cell) | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | SRR189787 | SRR015361(GSM380326) Memory B cells (MM55). (B cell) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR189782 | SRR015364(GSM380329) Plasma B cells (PC44). (B cell) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR033715(GSM497060) Mantle Cell Lymphoma (Mino122). (B cell) | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR033718(GSM497063) Multiple Myeloma (U266). (B cell) | SRR029124(GSM416753) HeLa. (hela) | SRR015359(GSM380324) Germinal Center B cell (GC136). (B cell) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | GSM450607(GSM450607) miRNA sequencing raw reads from post-mortem s. (brain) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR060984(GSM569188) Human plasma cell [09-001]. (cell line) | SRR189785 | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell) | SRR040008(GSM532893) G727N. (cervix) | SRR033726(GSM497071) Mututated CLL (CLLM633). (B cell) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | GSM450610(GSM450610) miRNA sequencing raw reads from post-mortem s. (brain) | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR015360(GSM380325) Plasma B cells (PC137). (B cell) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR033714(GSM497059) Burkitt Lymphoma (BL134). (B cell) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR060986(GSM569190) Human memory B cell [09-001]. (cell line) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | DRR001487(DRX001041) "Hela long nuclear cell fraction, LNA(+)". (hela) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .................................................GGTGAGCTCAGTGAGGACG...................................................................................................................................................................................... | 19 | 42.00 | 0.00 | - | 9.00 | 4.00 | - | 3.00 | - | 2.00 | 2.00 | - | 2.00 | - | - | 1.00 | 2.00 | - | - | - | - | - | 1.00 | - | 1.00 | 1.00 | - | 1.00 | - | - | - | 1.00 | - | 1.00 | - | 1.00 | - | - | 1.00 | - | - | - | 1.00 | - | 1.00 | - | 1.00 | 1.00 | 1.00 | - | 1.00 | 1.00 | - | 1.00 | - | 1.00 | - | - | - | |
| .............................................................................................................TTTTAATTACTAATCTTTTTT........................................................................................................................ | 21 | 1 | 6.00 | 6.00 | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................TTAAAGAGTAAAGAATGGAAAC................................................................................................................................................... | 22 | 1 | 3.00 | 3.00 | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................................................................GAGTACTGATAAGATGTTTT.. | 20 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................CTCCGTTTTAATTACTAATCTTT........................................................................................................................... | 23 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................AAAGAATGGAAACACTCCGTTTTAATTACTA................................................................................................................................. | 31 | 1 | 2.00 | 2.00 | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................CGTTTTAATTACTAATCTTT........................................................................................................................... | 20 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - |
| .................................................................................TTAAAGAGTAAAGAATGGA...................................................................................................................................................... | 19 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................AAATGGGTGAGCTCAGTGAGA......................................................................................................................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - |
| .............................................................................................................TTTTAATTACTAATCTTTTCT........................................................................................................................ | 21 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................GGTGAGCTCAGTGAGGCC....................................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................GAGTAAAGAATGGAAACACTCCGTTTTAATTACTAATCTTTTTTTCGTCTGCT............................................................................................................... | 53 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - |
| ..................................................................................................................................TCGTCTGCTGTTTATTGG...................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............CTAAGGGATATGGCTCTG............................................................................................................................................................................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............CTAAGGGATATGGCTTTG............................................................................................................................................................................................................................ | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................TTTTAATTACTAATCTTCTTT........................................................................................................................ | 21 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................AATCTTTTTTTCGTCTGCTGTTTACT........................................................................................................ | 26 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................TTTTAATTACTAATCTTTCTT........................................................................................................................ | 21 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................................................................................GCAGAGTACTGATAACTGA...... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........GTCTAAGGGATATGGCTTTGTCTC........................................................................................................................................................................................................................ | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - |
| .................................CCTTTTTCAACAAATGG........................................................................................................................................................................................................ | 17 | 0 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...CAGGAAAGTCTAAGGGATT.................................................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................TTTTTTTCGTCTGCTGTTTATTTTACTG.................................................................................................. | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................GTGAGCTCAGTGAGAACGG..................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................GGTGAGCTCAGTGAGGACA...................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................CCGTTTTAATTACTAATCTTT........................................................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................ATGGATAATGCTTAAAGAG................................................................................................................................................................. | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................AAATGGGTGAGCTCAGTGAGAAGTGCAT.................................................................................................................................................................................. | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................TTTTTCGTCTGCTGTTTATTTTACTG.................................................................................................. | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................TTTTAATTACTAATCTTATTA........................................................................................................................ | 21 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................AACACTCCGTTTTAATTACTAATCTTT........................................................................................................................... | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................CTCCTTTTTCAACAAATGG........................................................................................................................................................................................................ | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................ACAAATGGGTGAGCTCA............................................................................................................................................................................................... | 17 | 2 | 0.50 | 0.50 | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................TTAATTACTAATCTTT........................................................................................................................... | 16 | 7 | 0.29 | 0.29 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 | 0.14 |
| ..............................................................................................................TTTAATTACTAATCTTT........................................................................................................................... | 17 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| CAACAGGAAAGTCTAAGGGATATGGCTTTGTCTCCTTTTTCAACAAATGGGTGAGCTCAGTGAGAAGTGCATGGATAATGCTTAAAGAGTAAAGAATGGAAACACTCCGTTTTAATTACTAATCTTTTTTTCGTCTGCTGTTTATTTTACTGATGATTAAAATAAACCCTCACTAGAAGATTTCTTCTGTTTTGTCTGTTTAACATTTATTGGCACCTGAGGCATGCAGAGTACTGATAAGATGTTTTCA ...............................................((((....))))..((((((.((((.....))))......(((((((((((((.....))))))))..)))))......))))))...................................................................................................................... ............................................45.......................................................................................134.................................................................................................................. | Size | Perfect hit | Total Norm | Perfect Norm | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR015358(GSM380323) NaÌøve B Cell (Naive39). (B cell) | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | SRR189787 | SRR015361(GSM380326) Memory B cells (MM55). (B cell) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR189782 | SRR015364(GSM380329) Plasma B cells (PC44). (B cell) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR033715(GSM497060) Mantle Cell Lymphoma (Mino122). (B cell) | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR033718(GSM497063) Multiple Myeloma (U266). (B cell) | SRR029124(GSM416753) HeLa. (hela) | SRR015359(GSM380324) Germinal Center B cell (GC136). (B cell) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | GSM450607(GSM450607) miRNA sequencing raw reads from post-mortem s. (brain) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR060984(GSM569188) Human plasma cell [09-001]. (cell line) | SRR189785 | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell) | SRR040008(GSM532893) G727N. (cervix) | SRR033726(GSM497071) Mututated CLL (CLLM633). (B cell) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | GSM450610(GSM450610) miRNA sequencing raw reads from post-mortem s. (brain) | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR015360(GSM380325) Plasma B cells (PC137). (B cell) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR033714(GSM497059) Burkitt Lymphoma (BL134). (B cell) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR060986(GSM569190) Human memory B cell [09-001]. (cell line) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | DRR001487(DRX001041) "Hela long nuclear cell fraction, LNA(+)". (hela) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ........AAGTCTAAGGGATATAC................................................................................................................................................................................................................................. | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................TACTAATCTTTTTTTCGCA................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................GATTAAAATAAACCCTCTGT............................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |