ID: uc002sdp.2_intron_8_0_chr2_65492310_f.3p
GENE: (9)
chr2:65495498-65495747+


(1)
AGO1.ip 		(3)
AGO2.ip 		(1)
AGO3.ip 		(29)
B-CELL 		(11)
BRAIN 		(162)
BREAST 		(35)
CELL-LINE 		(24)
CERVIX 		(2)
HEART 		(1)
HELA 		(8)
LIVER 		(3)
OTHER 		(1)
RRP40.ip 		(22)
SKIN 		(1)
TESTES 		(2)
UTERUS 		(1)
XRN.ip

Sense strand
GATGGATGTGTGGTCTCCTAAACATGAGCTTTGGGCAAATTACTAAATGTTTCTGTACCTCAGGTACCAAATATTACGTTCTACTTATATTACAGGACTGTTGCAAGTTTGAGGGAGAGCATATATTTAAAAAGCCATTTTCATAAAGCAGAAAGCACTGTGCACATGTACCATTTCATTATCCTTTCTTTCTCCTTTAGAAATTTAAGATCCGCATTGAAGACCCACCCCGCAGAAAGCACATGGTATT
...............................................................................................................................................(((((.((((((....((((....))))................)))))).)))))...................................................
........................................................................................................................................137............................................................200................................................
SizePerfect hitTotal NormPerfect NormSRR387910(GSM843862)
antibody for ip: Ago2. (ago2 cell line)		SRR189787SRR189786SRR343334SRR343335SRR060986(GSM569190)
Human memory B cell [09-001]. (cell line)		SRR033721(GSM497066)
Ly3 cell line (Ly3). (B cell)		SRR033726(GSM497071)
Mututated CLL (CLLM633). (B cell)		TAX577740(Rovira)
total RNA. (breast)		SRR033725(GSM497070)
Unmutated CLL (CLLU626). (B cell)		SRR033723(GSM497068)
L1236 cell line (L1236). (B cell)		SRR060981(GSM569185)
Human centroblast [09-001]. (cell line)		SRR189784SRR343336SRR343337TAX577738(Rovira)
total RNA. (breast)		SRR033719(GSM497064)
6hr Activated B cell line (ABC158). (B cell)		SRR033720(GSM497065)
EBV activated B cell line (EBV159). (B cell)		SRR060982(GSM569186)
Human centrocyte [09-001]. (cell line)		SRR040010(GSM532895)
G529N. (cervix)		SRR033722(GSM497067)
KMS12 cell line (KMS12). (B cell)		SRR033714(GSM497059)
Burkitt Lymphoma (BL134). (B cell)		SRR060983(GSM569187)
Human pre-germinal center B cell [09-001]. (cell line)		TAX577739(Rovira)
total RNA. (breast)		SRR191570(GSM715680)
56genomic small RNA (size selected RNA from t. (breast)		DRR000556(DRX000314)
"THP-1 whole cell RNA, after 3 day treatment . (cell line)		SRR060984(GSM569188)
Human plasma cell [09-001]. (cell line)		SRR191475(GSM715585)
18genomic small RNA (size selected RNA from t. (breast)		TAX577744(Rovira)
total RNA. (breast)		SRR040015(GSM532900)
G623T. (cervix)		SRR040028(GSM532913)
G026N. (cervix)		TAX577743(Rovira)
total RNA. (breast)		SRR015361(GSM380326)
Memory B cells (MM55). (B cell)		SRR015358(GSM380323)
NaÌøve B Cell (Naive39). (B cell)		TAX577745(Rovira)
total RNA. (breast)		SRR191409(GSM715519)
19genomic small RNA (size selected RNA from t. (breast)		SRR033724(GSM497069)
L428 cell line (L428). (B cell)		SRR191404(GSM715514)
47genomic small RNA (size selected RNA from t. (breast)		SRR191625(GSM715735)
32genomic small RNA (size selected RNA from t. (breast)		SRR191615(GSM715725)
94genomic small RNA (size selected RNA from t. (breast)		SRR040018(GSM532903)
G701N. (cervix)		SRR191413(GSM715523)
28genomic small RNA (size selected RNA from t. (breast)		SRR060985(GSM569189)
Human naive B cell [09-001]. (cell line)		SRR191442(GSM715552)
107genomic small RNA (size selected RNA from . (breast)		SRR191410(GSM715520)
20genomic small RNA (size selected RNA from t. (breast)		SRR191598(GSM715708)
79genomic small RNA (size selected RNA from t. (breast)		SRR033710(GSM497055)
GCB DLBCL (GCB385). (B cell)		DRR000559(DRX000317)
"THP-1 whole cell RNA, no treatment". (cell line)		SRR033728(GSM497073)
MALT (MALT413). (B cell)		SRR191576(GSM715686)
86genomic small RNA (size selected RNA from t. (breast)		SRR191612(GSM715722)
65genomic small RNA (size selected RNA from t. (breast)		DRR000555(DRX000313)
"THP-1 whole cell RNA, no treatment". (cell line)		SRR191568(GSM715678)
51genomic small RNA (size selected RNA from t. (breast)		SRR033715(GSM497060)
Mantle Cell Lymphoma (Mino122). (B cell)		SRR191632(GSM715742)
78genomic small RNA (size selected RNA from t. (breast)		SRR040025(GSM532910)
G613T. (cervix)		SRR191551(GSM715661)
32genomic small RNA (size selected RNA from t. (breast)		SRR191396(GSM715506)
29genomic small RNA (size selected RNA from t. (breast)		SRR191406(GSM715516)
67genomic small RNA (size selected RNA from t. (breast)		SRR191423(GSM715533)
137genomic small RNA (size selected RNA from . (breast)		TAX577579(Rovira)
total RNA. (breast)		SRR191443(GSM715553)
108genomic small RNA (size selected RNA from . (breast)		SRR191412(GSM715522)
24genomic small RNA (size selected RNA from t. (breast)		GSM532878(GSM532878)
G691T. (cervix)		SRR015359(GSM380324)
Germinal Center B cell (GC136). (B cell)		DRR000561(DRX000319)
Isolation of RNA following immunoprecipitatio. (ago2 cell line)		SRR191397(GSM715507)
30genomic small RNA (size selected RNA from t. (breast)		SRR191573(GSM715683)
68genomic small RNA (size selected RNA from t. (breast)		DRR000558(DRX000316)
"THP-1 whole cell RNA, after 3 day treatment . (cell line)		SRR191565(GSM715675)
92genomic small RNA (size selected RNA from t. (breast)		SRR191458(GSM715568)
28genomic small RNA (size selected RNA from t. (breast)		SRR040027(GSM532912)
G220T. (cervix)		GSM532872(GSM532872)
G652T. (cervix)		DRR000557(DRX000315)
"THP-1 whole cell RNA, after 3 day treatment . (cell line)		SRR039637(GSM518474)
THP1_total_sRNAs. (cell line)		SRR033716(GSM497061)
Mentle Cell Lymphoma (MCL114). (B cell)		SRR033727(GSM497072)
HIV-positive DL (HIV412). (B cell)		SRR191417(GSM715527)
39genomic small RNA (size selected RNA from t. (breast)		SRR191564(GSM715674)
87genomic small RNA (size selected RNA from t. (breast)		SRR191455(GSM715565)
181genomic small RNA (size selected RNA from . (breast)		SRR387909(GSM843861)
specific-host: Homo sapienshost cell line: Su. (cell line)		SRR191433(GSM715543)
170genomic small RNA (size selected RNA from . (breast)		SRR191451(GSM715561)
177genomic small RNA (size selected RNA from . (breast)		SRR191614(GSM715724)
92genomic small RNA (size selected RNA from t. (breast)		SRR039191(GSM494810)
PBMCs were isolated by ficoll gradient from t. (blood)		SRR191469(GSM715579)
117genomic small RNA (size selected RNA from . (breast)		SRR191603(GSM715713)
71genomic small RNA (size selected RNA from t. (breast)		SRR191569(GSM715679)
54genomic small RNA (size selected RNA from t. (breast)		SRR191459(GSM715569)
32genomic small RNA (size selected RNA from t. (breast)		GSM450608(GSM450608)
miRNA sequencing raw reads from post-mortem s. (brain)		TAX577589(Rovira)
total RNA. (breast)		SRR191471(GSM715581)
119genomic small RNA (size selected RNA from . (breast)		SRR191601(GSM715711)
58genomic small RNA (size selected RNA from t. (breast)		SRR191394(GSM715504)
23genomic small RNA (size selected RNA from t. (breast)		SRR039193(GSM494812)
HL60 cell line is derived from acute promyelo. (cell line)		SRR189781(GSM714641)
cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)		SRR039625(GSM531988)
HBV(-) HCV(-) HCC Tissue Sample. (liver)		SRR191566(GSM715676)
94genomic small RNA (size selected RNA from t. (breast)		SRR033717(GSM497062)
Mentle Cell Lymphoma (MCL112). (B cell)		SRR191519(GSM715629)
86genomic small RNA (size selected RNA from t. (breast)		SRR191577(GSM715687)
93genomic small RNA (size selected RNA from t. (breast)		SRR191408(GSM715518)
88genomic small RNA (size selected RNA from t. (breast)		SRR191593(GSM715703)
62genomic small RNA (size selected RNA from t. (breast)		SRR191535(GSM715645)
181genomic small RNA (size selected RNA from . (breast)		SRR039192(GSM494811)
K562 cell line is derived from a CML patient . (cell line)		SRR040007(GSM532892)
G601T. (cervix)		GSM450602(GSM450602)
miRNA sequencing raw reads from post-mortem s. (brain)		SRR015360(GSM380325)
Plasma B cells (PC137). (B cell)		SRR191521(GSM715631)
92genomic small RNA (size selected RNA from t. (breast)		SRR191399(GSM715509)
36genomic small RNA (size selected RNA from t. (breast)		SRR191473(GSM715583)
121genomic small RNA (size selected RNA from . (breast)		SRR033729(GSM497074)
splenic MZL (Splenic414). (B cell)		SRR191545(GSM715655)
139genomic small RNA (size selected RNA from . (breast)		SRR015364(GSM380329)
Plasma B cells (PC44). (B cell)		TAX577741(Rovira)
total RNA. (breast)		SRR191439(GSM715549)
176genomic small RNA (size selected RNA from . (breast)		SRR191464(GSM715574)
112genomic small RNA (size selected RNA from . (breast)		SRR191574(GSM715684)
78genomic small RNA (size selected RNA from t. (breast)		SRR191575(GSM715685)
85genomic small RNA (size selected RNA from t. (breast)		SRR191587(GSM715697)
50genomic small RNA (size selected RNA from t. (breast)		SRR191428(GSM715538)
160genomic small RNA (size selected RNA from . (breast)		SRR191421(GSM715531)
122genomic small RNA (size selected RNA from . (breast)		SRR039620(GSM531983)
HBV(+) Adjacent Tissue Sample 2. (liver)		SRR191633(GSM715743)
85genomic small RNA (size selected RNA from t. (breast)		GSM450601(GSM450601)
miRNA sequencing raw reads from post-mortem s. (brain)		SRR191592(GSM715702)
59genomic small RNA (size selected RNA from t. (breast)		SRR191557(GSM715667)
57genomic small RNA (size selected RNA from t. (breast)		SRR191405(GSM715515)
55genomic small RNA (size selected RNA from t. (breast)		SRR191452(GSM715562)
178genomic small RNA (size selected RNA from . (breast)		SRR343333(GSM796036)
KSHV (HHV8). (cell line)		SRR040023(GSM532908)
G575T. (cervix)		SRR191621(GSM715731)
16genomic small RNA (size selected RNA from t. (breast)		SRR191629(GSM715739)
5genomic small RNA (size selected RNA from to. (breast)		SRR191626(GSM715736)
36genomic small RNA (size selected RNA from t. (breast)		SRR191620(GSM715730)
167genomic small RNA (size selected RNA from . (breast)		SRR191559(GSM715669)
65genomic small RNA (size selected RNA from t. (breast)		SRR191597(GSM715707)
75genomic small RNA (size selected RNA from t. (breast)		SRR191627(GSM715737)
45genomic small RNA (size selected RNA from t. (breast)		SRR191456(GSM715566)
182genomic small RNA (size selected RNA from . (breast)		SRR191624(GSM715734)
31genomic small RNA (size selected RNA from t. (breast)		SRR015365(GSM380330)
Memory B cells (MM139). (B cell)		SRR191560(GSM715670)
77genomic small RNA (size selected RNA from t. (breast)		SRR191438(GSM715548)
175genomic small RNA (size selected RNA from . (breast)		SRR191393(GSM715503)
22genomic small RNA (size selected RNA from t. (breast)		SRR191448(GSM715558)
143genomic small RNA (size selected RNA from . (breast)		SRR191402(GSM715512)
43genomic small RNA (size selected RNA from t. (breast)		SRR191622(GSM715732)
175genomic small RNA (size selected RNA from . (breast)		SRR444059(SRX128907)
Sample 17cDNABarcode: AF-PP-339: ACG CTC TTC . (skin)		RoviraIPAgo2(Rovira)
total RNA. (ago2 breast)		SRR033712(GSM497057)
Burkitt Lymphoma (BL510). (B cell)		SRR330905(SRX091743)
tissue: normal skindisease state: normal. (skin)		SRR191477(GSM715587)
2genomic small RNA (size selected RNA from to. (breast)		SRR191478(GSM715588)
30genomic small RNA (size selected RNA from t. (breast)		SRR037935(GSM510473)
293cand3. (cell line)		SRR191463(GSM715573)
111genomic small RNA (size selected RNA from . (breast)		DRR000562(DRX000320)
Isolation of RNA following immunoprecipitatio. (ago3 cell line)		SRR191604(GSM715714)
74genomic small RNA (size selected RNA from t. (breast)		SRR040019(GSM532904)
G701T. (cervix)		SRR191515(GSM715625)
4genomic small RNA (size selected RNA from to. (breast)		SRR553572(SRX182778)
source: Frontal Cortex. (Frontal Cortex)		SRR191508(GSM715618)
152genomic small RNA (size selected RNA from . (breast)		SRR191499(GSM715609)
6genomic small RNA (size selected RNA from to. (breast)		GSM450604(GSM450604)
miRNA sequencing raw reads from post-mortem s. (brain)		SRR191426(GSM715536)
149genomic small RNA (size selected RNA from . (breast)		SRR040016(GSM532901)
G645N. (cervix)		SRR191454(GSM715564)
180genomic small RNA (size selected RNA from . (breast)		SRR191465(GSM715575)
113genomic small RNA (size selected RNA from . (breast)		GSM450609(GSM450609)
miRNA sequencing raw reads from post-mortem s. (brain)		SRR191444(GSM715554)
109genomic small RNA (size selected RNA from . (breast)		SRR191489(GSM715599)
147genomic small RNA (size selected RNA from . (breast)		GSM1105753INPUT(GSM1105753)
small RNA sequencing data. (hela)		SRR191611(GSM715721)
57genomic small RNA (size selected RNA from t. (breast)		SRR191425(GSM715535)
141genomic small RNA (size selected RNA from . (breast)		SRR189782SRR191589(GSM715699)
69genomic small RNA (size selected RNA from t. (breast)		SRR191466(GSM715576)
114genomic small RNA (size selected RNA from . (breast)		SRR040031(GSM532916)
G013T. (cervix)		SRR191578(GSM715688)
100genomic small RNA (size selected RNA from . (breast)		SRR191403(GSM715513)
44genomic small RNA (size selected RNA from t. (breast)		SRR189779(GSM714639)
cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)		SRR040022(GSM532907)
G575N. (cervix)		SRR191546(GSM715656)
152genomic small RNA (size selected RNA from . (breast)		SRR191432(GSM715542)
169genomic small RNA (size selected RNA from . (breast)		SRR039635(GSM518472)
THP1_nuc_sRNAs. (cell line)		SRR033713(GSM497058)
Burkitt Lymphoma (BL115). (B cell)		SRR191415(GSM715525)
33genomic small RNA (size selected RNA from t. (breast)		SRR191429(GSM715539)
166genomic small RNA (size selected RNA from . (breast)		SRR444051(SRX128899)
Sample 11cDNABarcode: AF-PP-339: ACG CTC TTC . (skin)		SRR191474(GSM715584)
16genomic small RNA (size selected RNA from t. (breast)		SRR191461(GSM715571)
35genomic small RNA (size selected RNA from t. (breast)		SRR191414(GSM715524)
31genomic small RNA (size selected RNA from t. (breast)		SRR039622(GSM531985)
HCV(+) Adjacent Tissue Sample. (liver)		SRR191453(GSM715563)
179genomic small RNA (size selected RNA from . (breast)		SRR191623(GSM715733)
18genomic small RNA (size selected RNA from t. (breast)		TAX577453(Rovira)
total RNA. (breast)		SRR040035(GSM532920)
G001T. (cervix)		SRR191472(GSM715582)
120genomic small RNA (size selected RNA from . (breast)		GSM532885(GSM532885)
G850N. (cervix)		SRR191497(GSM715607)
17genomic small RNA (size selected RNA from t. (breast)		SRR444040(SRX128888)
Sample 1cDNABarcode: AF-PP-333: ACG CTC TTC C. (skin)		SRR033711(GSM497056)
GCB DLBCL (GCB110). (B cell)		SRR342899(SRX096795)
small RNA seq of Left atrial tissue. (heart)		SRR330890(SRX091728)
tissue: skin psoriatic uninvolveddisease stat. (skin)		SRR039616(GSM531979)
HBV(+) Distal Tissue Sample 1. (liver)		SRR015363(GSM380328)
Germinal Center B cell (GC40). (B cell)		SRR040011(GSM532896)
G529T. (cervix)		TAX577742(Rovira)
total RNA. (breast)		GSM450600(GSM450600)
miRNA sequencing raw reads from post-mortem s. (brain)		SRR191563(GSM715673)
83genomic small RNA (size selected RNA from t. (breast)		SRR191427(GSM715537)
153genomic small RNA (size selected RNA from . (breast)		SRR191520(GSM715630)
89genomic small RNA (size selected RNA from t. (breast)		SRR191605(GSM715715)
76genomic small RNA (size selected RNA from t. (breast)		SRR191398(GSM715508)
35genomic small RNA (size selected RNA from t. (breast)		SRR037942(GSM510480)
293DroshaTN_cand5. (cell line)		SRR191436(GSM715546)
173genomic small RNA (size selected RNA from . (breast)		SRR191420(GSM715530)
122genomic small RNA (size selected RNA from . (breast)		SRR033718(GSM497063)
Multiple Myeloma (U266). (B cell)		SRR191419(GSM715529)
41genomic small RNA (size selected RNA from t. (breast)		SRR037936(GSM510474)
293cand1. (cell line)		SRR191543(GSM715653)
124genomic small RNA (size selected RNA from . (breast)		SRR330857(SRX091695)
tissue: skin psoriatic involveddisease state:. (skin)		SRR191462(GSM715572)
1genomic small RNA (size selected RNA from to. (breast)		SRR039615(GSM531978)
Severe Chronic Hepatitis B Liver Tissue. (liver)		TAX577746(Rovira)
total RNA. (breast)		GSM450607(GSM450607)
miRNA sequencing raw reads from post-mortem s. (brain)		SRR094130(GSM651906)
small RNA(18-35nt)small RNA deep sequencing o. (uterus)		SRR330892(SRX091730)
tissue: skin psoriatic uninvolveddisease stat. (skin)		SRR191480(GSM715590)
38genomic small RNA (size selected RNA from t. (breast)		SRR191590(GSM715700)
48genomic small RNA (size selected RNA from t. (breast)		SRR207111(GSM721073)
Whole cell RNA. (cell line)		SRR444058(SRX128906)
Sample 16cDNABarcode: AF-PP-335: ACG CTC TTC . (skin)		SRR191476(GSM715586)
19genomic small RNA (size selected RNA from t. (breast)		SRR039618(GSM531981)
HBV(+) Side Tissue Sample 1. (liver)		SRR342901(SRX096797)
small RNA seq of Left atrial tissue. (heart)		SRR191509(GSM715619)
156genomic small RNA (size selected RNA from . (breast)		SRR040009(GSM532894)
G727T. (cervix)		SRR094131(GSM651907)
small RNA(18-35nt)small RNA deep sequencing o. (uterus)		SRR553573(SRX182779)
source: Cerebellum. (Cerebellum)		SRR191491(GSM715601)
150genomic small RNA (size selected RNA from . (breast)		GSM532874(GSM532874)
G699T. (cervix)		SRR207118(GSM721080)
RRP40 knockdown. (RRP40 cell line)		SRR191500(GSM715610)
7genomic small RNA (size selected RNA from to. (breast)		SRR191556(GSM715666)
45genomic small RNA (size selected RNA from t. (breast)		SRR040036(GSM532921)
G243N. (cervix)		SRR191494(GSM715604)
157genomic small RNA (size selected RNA from . (breast)		SRR040008(GSM532893)
G727N. (cervix)		SRR444048(SRX128896)
Sample 8cDNABarcode: AF-PP-333: ACG CTC TTC C. (skin)		SRR095854(SRX039177)
"miRNA were isolated from FirstChoice Human B. (brain)		SRR191503(GSM715613)
10genomic small RNA (size selected RNA from t. (breast)		SRR191418(GSM715528)
40genomic small RNA (size selected RNA from t. (breast)		SRR191523(GSM715633)
107genomic small RNA (size selected RNA from . (breast)		SRR191450(GSM715560)
145genomic small RNA (size selected RNA from . (breast)		SRR191594(GSM715704)
70genomic small RNA (size selected RNA from t. (breast)		SRR033732(GSM497077)
bjab cell line (bjab103). (B cell)		SRR189780(GSM714640)
cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)		SRR191416(GSM715526)
34genomic small RNA (size selected RNA from t. (breast)		SRR191498(GSM715608)
3genomic small RNA (size selected RNA from to. (breast)		SRR191617(GSM715727)
104genomic small RNA (size selected RNA from . (breast)		SRR330899(SRX091737)
tissue: skin psoriatic uninvolveddisease stat. (skin)		SRR191483(GSM715593)
11genomic small RNA (size selected RNA from t. (breast)		SRR191517(GSM715627)
75genomic small RNA (size selected RNA from t. (breast)		SRR191548(GSM715658)
101genomic small RNA (size selected RNA from . (breast)		SRR191524(GSM715634)
119genomic small RNA (size selected RNA from . (breast)		SRR330874(SRX091712)
tissue: skin psoriatic involveddisease state:. (skin)		SRR040033(GSM532918)
G603T. (cervix)		SRR040038(GSM532923)
G531N. (cervix)		SRR191502(GSM715612)
9genomic small RNA (size selected RNA from to. (breast)		SRR191595(GSM715705)
72genomic small RNA (size selected RNA from t. (breast)		SRR037940(GSM510478)
293cand5_rep2. (cell line)		SRR207115(GSM721077)
XRN1&2 knockdown. (XRN1/XRN2 cell line)		SRR191505(GSM715615)
139genomic small RNA (size selected RNA from . (breast)		SRR330870(SRX091708)
tissue: skin psoriatic involveddisease state:. (skin)		SRR191440(GSM715550)
26genomic small RNA (size selected RNA from t. (breast)		SRR330877(SRX091715)
tissue: skin psoriatic involveddisease state:. (skin)		SRR040032(GSM532917)
G603N. (cervix)		SRR191401(GSM715511)
38genomic small RNA (size selected RNA from t. (breast)		SRR191422(GSM715532)
129genomic small RNA (size selected RNA from . (breast)		SRR191602(GSM715712)
60genomic small RNA (size selected RNA from t. (breast)		SRR060169(GSM565979)
5-8F_cytoplasm. (cell line)		SRR330915(SRX091753)
tissue: normal skindisease state: normal. (skin)		GSM450599(GSM450599)
miRNA sequencing raw reads from post-mortem s. (brain)		SRR191582(GSM715692)
95genomic small RNA (size selected RNA from t. (breast)		SRR191526(GSM715636)
127genomic small RNA (size selected RNA from . (breast)		SRR191591(GSM715701)
53genomic small RNA (size selected RNA from t. (breast)		GSM450605(GSM450605)
miRNA sequencing raw reads from post-mortem s. (brain)		SRR444043(SRX128891)
Sample 4cDNABarcode: AF-PP-339: ACG CTC TTC C. (skin)		SRR039619(GSM531982)
HBV(+) HCC Tissue Sample 1. (liver)		SRR330866(SRX091704)
tissue: skin psoriatic involveddisease state:. (skin)		SRR330920(SRX091758)
tissue: normal skindisease state: normal. (skin)		DRR000560(DRX000318)
Isolation of RNA following immunoprecipitatio. (ago1 cell line)		SRR330876(SRX091714)
tissue: skin psoriatic involveddisease state:. (skin)		SRR191540(GSM715650)
62genomic small RNA (size selected RNA from t. (breast)		SRR189778(GSM714638)
cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)		SRR039623(GSM531986)
HCV(+) HCC Tissue Sample. (liver)		SRR033731(GSM497076)
h929 Cell line (h929). (B cell)		SRR191430(GSM715540)
167genomic small RNA (size selected RNA from . (breast)		SRR326281(GSM769511)
"Dicer mRNA was knocked down using siDicer, c. (cell line)		SRR330859(SRX091697)
tissue: skin psoriatic involveddisease state:. (skin)		SRR191479(GSM715589)
31genomic small RNA (size selected RNA from t. (breast)		SRR189777(GSM714637)
cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)		SRR330896(SRX091734)
tissue: skin psoriatic uninvolveddisease stat. (skin)		SRR330894(SRX091732)
tissue: skin psoriatic uninvolveddisease stat. (skin)		GSM450606(GSM450606)
miRNA sequencing raw reads from post-mortem s. (brain)		SRR191588(GSM715698)
52genomic small RNA (size selected RNA from t. (breast)		SRR191431(GSM715541)
168genomic small RNA (size selected RNA from . (breast)		SRR191446(GSM715556)
140genomic small RNA (size selected RNA from . (breast)		SRR330879(SRX091717)
tissue: skin psoriatic involveddisease state:. (skin)		SRR553576(SRX182782)
source: Testis. (testes)
.............................................................................................................................................CATAAAGCAGAAAGCACTACT........................................................................................2111448.0088.00610.0098.0025.0079.0069.003.005.006.004.005.007.004.006.0022.0021.007.00--3.0016.005.002.00-1.0013.0010.00-13.003.006.0013.00--1.006.007.003.008.009.007.008.0010.00-7.007.006.00-3.00-6.008.006.007.002.005.005.005.006.005.003.00-4.006.001.001.004.002.001.005.005.005.002.004.002.001.002.002.002.004.003.005.001.003.002.00-3.004.004.001.00--4.003.005.003.00--1.001.003.002.00-2.002.001.001.00---3.003.001.001.00-2.00-1.001.002.001.002.001.00-1.001.003.002.003.003.001.001.003.001.001.003.002.003.002.001.003.001.003.001.001.003.003.003.00--1.00-1.001.001.001.002.001.00-2.00-1.002.001.001.001.001.001.00-1.002.00-2.00---1.00-2.00--1.002.002.00-1.002.001.001.00----2.001.00-1.001.001.002.002.001.00----1.00---1.001.00----1.00----1.00------1.001.00------1.00---1.00----1.001.00--1.001.001.00-----1.001.00-1.00--1.00-1.001.00-1.001.00-1.001.00----1.001.00---1.00-1.00-----1.00-----1.00--1.00---------
.............................................................................................................................................CATAAAGCAGAAAGCACTACTA.......................................................................................221791.0088.0051.00274.00167.0039.0053.001.008.001.003.003.0012.001.0029.0013.009.002.001.001.00-2.0012.002.001.005.002.005.00---1.001.003.00---2.00---1.002.00--1.002.001.001.002.00-3.003.001.00-4.004.00-1.001.001.001.00---2.00--2.003.00-1.00---2.001.00-1.00-2.00--1.00-1.00-1.00-1.002.002.001.00-1.00----1.00-1.00-1.001.001.001.00---1.00---------1.00--2.00-1.001.00-1.00--1.00-------1.002.00---1.00----------1.00------1.00----1.001.00-------1.00---1.00-------1.00--1.00-----1.00---------------1.00----------------------1.00---1.00--------------1.00------1.00--------------1.00------------------1.00-------------
.............................................................................................................................................CATAAAGCAGAAAGCACTA..........................................................................................191443.0088.0015.001.00-5.001.0038.0024.0025.0028.0021.0015.0021.00---10.0017.0017.0017.003.006.0012.0011.009.004.00-11.00-7.004.00-5.009.006.005.001.008.001.002.003.00-2.005.002.00--6.00-4.00---1.001.00-1.00----1.001.00-2.003.00-1.001.00-1.00--1.00-3.002.002.00--1.00--1.001.001.00----1.00----1.00--1.003.00-----1.00-2.002.00---2.00-2.00--------1.00------1.00--1.00-------1.00-1.001.00-----1.00-------1.00---------2.00-------1.00--------1.00------1.00-----1.00------1.00-1.00-1.00---------------------1.00-----1.00---------1.00-----------1.00-------------------------1.00-----------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTAC.........................................................................................201222.0088.0066.002.001.0019.0023.002.005.004.003.002.005.005.00--1.008.001.001.001.004.001.00-1.002.001.002.002.00-1.002.002.001.00--1.001.002.001.00--3.00--1.001.00-1.007.001.00--1.00---1.00-------2.00-2.00--2.00--1.001.001.00---2.00-1.00-1.00-----------------------1.002.00----1.001.00-1.001.00---1.00----------1.00--1.00--------------------------------------1.00---1.00----------1.00------1.00------------------------1.00-1.001.00--------------------------------1.00-----------------------1.00----------1.00-----------------
..............................................................................................................................................ATAAAGCAGAAAGCACTACT........................................................................................201103.003.0021.001.00-9.006.00-1.001.00-1.00-1.00-1.002.00---------1.001.00-1.00-1.00----1.002.00-1.002.001.00----1.001.00---1.00------2.00-2.002.00-1.00----2.00---1.00------2.00-1.001.001.001.00---1.00-1.00-----------1.002.00------1.001.00--1.00---1.001.00-1.00---1.00-------------------1.00---1.00----1.00---1.00-----------1.00-------1.00------------1.001.00--1.00------------------1.001.00---1.00--------------1.00--------1.00---------1.00--------------------1.00------------1.00----------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTAA.........................................................................................20191.0088.002.00----13.001.002.006.009.00-3.00---2.006.006.003.001.00-1.004.001.00--1.00-2.001.00--1.005.00-1.00------4.00--1.002.00-3.00-----------1.00------1.00----------------2.00-----1.00----------------1.001.00-----------1.00---1.00----------1.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACT...........................................................................................18188.0088.005.00--4.001.009.004.004.005.001.003.005.00---2.002.002.001.00-1.005.003.003.00-1.002.00-1.001.001.002.002.00--1.00---1.00----1.00-1.00-1.00----------------------1.00---1.00-------1.001.00-------1.00---1.00--------1.00-1.00----------------------1.00--------------------------1.00--------------------1.00----1.00--------------------------------------------------------------------------------------------------1.00-------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTACCA.......................................................................................22157.0088.001.0038.0012.003.00--------2.00-----------------------------------------------------------------------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................................................ATAAAGCAGAAAGCACTACTA.......................................................................................21150.003.004.002.00-13.009.001.002.002.001.00-4.00-1.00---------------1.00--------------------------------------1.00---------------------------------1.001.00-1.001.00---------1.00-1.00-----------------------------1.00--------------1.00--------------------------------------------------------------1.00----------------------------------------------------------------------------------
..............................................................................................................................................ATAAAGCAGAAAGCACTA..........................................................................................18139.003.00---3.00-1.007.001.00-4.002.001.00----3.003.001.00-1.001.001.002.00--2.00------------------1.00----------------------------1.001.00--------------1.00-------------------------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00---------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTAT.........................................................................................20123.0088.004.00-----3.003.00-1.00-1.00--------------1.001.00----1.00-1.00-1.00-----2.00----------1.00------1.00---1.00---------------------------------------------------------------------------1.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTACC........................................................................................21119.0088.001.006.00-5.004.00---1.00--------------------------------------------------1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00----------------
..............................................................................................................................................ATAAAGCAGAAAGCACTAA.........................................................................................19118.003.00-1.00---4.00-1.001.004.00-1.00---1.001.001.00--1.00--------------------------------------------------------------------1.00---------------------------------------------------------------------------------------------------------------------1.00----------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTAAA........................................................................................21117.0088.00-----3.00-1.00-1.001.00-----1.001.001.00---------------------------1.00-1.00-----------2.00----------1.00--------------------------------------------------1.00---------1.00-------------------------------1.00-----------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTACA........................................................................................21115.0088.003.001.00------1.00---------------1.00------1.00-----1.00-------1.00-----1.00---1.00-----------------------------------------1.00-----------------1.00------------------------------------------------------------------------1.00-------------------------------------------------------------------------------------1.00---------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTAAAA.......................................................................................22114.0088.00-----2.00-6.00----------1.00---1.00---------2.001.00----1.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................................................ATAAAGCAGAAAGCACTAC.........................................................................................19112.003.001.00--5.003.00-1.00-------------1.00---------------------------------------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTCCT........................................................................................21112.0088.001.00------------------3.00----------1.00---------------------1.00-------------------1.00-----------------------------------1.00---------------------------------------------1.00-------------------------1.00---------1.00---------------------------1.00-----------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACCACT........................................................................................21411.504.251.004.501.000.250.750.50--0.50------0.25---------------0.500.25---------------0.25------------0.25-------------------0.25------------------------------0.250.25-----------------------------------------------------------------------------------------0.25-0.25-------------------------------------------------------------------------------------------------0.25----
.............................................................................................................................................CATAAAGCAGAAAGCACTACTT.......................................................................................22110.0088.001.001.001.001.00---------1.004.00------------1.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTAAT........................................................................................2118.0088.001.00--------------------------1.00---------1.00-----1.00-------1.00---1.00---------1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00----------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTC..........................................................................................1918.0088.00-----1.00---1.00-1.00------------------------1.00------------------------------------1.00----------------1.00----------------------1.00--------------------------------------------------------------------------------1.00-----------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTACG........................................................................................2117.0088.001.00--2.00-------------------------------------1.00------------------------------------------------1.00------------------------------------------1.00------------------------------------------------------------------------------------------1.00-----------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTAG.........................................................................................2017.0088.00-----2.00---1.00------1.001.00--------------1.00-----------------------------1.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTAGA........................................................................................2116.0088.00-----1.00----------1.001.00---------------1.001.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00----------
.............................................................................................................................................CATAAAGCAGAAAGCACTT..........................................................................................1916.0088.00-----3.00-----1.00---------1.00-1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTTCT........................................................................................2115.0088.00----------------1.001.00-1.00--------------------------------1.00-1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................................................ATAAAGCAGAAAGCACTACC........................................................................................2015.003.00---1.001.00----------------------------------------------------1.00------------1.00-----------------------------------------------------------------------------------------------------------------------------------------------1.00---------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTACAA.......................................................................................2215.0088.00-1.00-----1.00-----------------------------------------1.00--------------------------------------1.00--------------------------------------------------------------------------------------------------------------------------------------1.00------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTATTA.......................................................................................2215.0088.00--------1.00-2.00------------------------------------------1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00-------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTGCT........................................................................................2115.001.002.00-1.00--------------------------1.00-----------------------------------------1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCAC............................................................................................1744.254.25---0.251.00----------0.75------------0.50--1.25----------------------------0.25------------0.25------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTATA........................................................................................2113.0088.00--------1.00------------------------1.00--------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCAGT...........................................................................................183.000.00-----1.00------------1.00---------------------------------------------1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTAGTA.......................................................................................2213.0088.00-1.00------------------1.00----------------------------------------------------------------------------------------------------------------------------------1.00------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTATT........................................................................................2113.0088.001.00--------------------------2.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
...........................................................................................................................................................................................................TTTAAGATCCGCATTGAAGACC.........................2213.003.00------------------------------------------------------------1.00-------------------------------------------------------------------------------------------------------------2.00-----------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCAGTA..........................................................................................193.000.00-----2.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00--------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTACTC.......................................................................................2213.0088.00-------------------1.00------------------------------------------------------------------------------------------1.00-------------------------------------------------------------1.00---------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................................................ATAAAGCAGAAAGCACT...........................................................................................1713.003.00----1.00-----------------------1.00----------1.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTACGA.......................................................................................2213.0088.00-1.00---------------------------------------------------1.00-----------------------------------1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACCA..........................................................................................1942.504.25----0.250.50--0.25--0.25------0.25-0.25----------0.25----------------------------0.25-----------------------------------------------------------------------------------------------------------------------------------------------0.25-------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTCA.........................................................................................2012.0088.00-----1.00---------------------------------------1.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................................................ATAAAGCAGAAAGCACTAGT........................................................................................2012.003.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00------------------------------------------------------------------------------------------------------1.00-----------------------------------------
..............................................................................................................................................ATAAAGCAGAAAGCACTACA........................................................................................2012.003.00-------------------------------1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00-----------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCATTA..........................................................................................192.000.00---------------------1.00------1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACGA..........................................................................................1942.004.25-----------1.00----------0.25---------------------------------------------------0.25-----------------------------------------------------------------------------------------------------------------------------------0.250.25----------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTAAG........................................................................................2112.0088.00---------1.00--------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTCC.........................................................................................2012.0088.00-----1.00---------1.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................................................................................................................AAGATCCGCATTGAAGACCCACCCCGCAGAAAG...........3312.002.00----------------------------------------------------------------------------------------------------------------------------------------------------2.00---------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTTC.........................................................................................2012.0088.00----------------------------------------------------------------1.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00----------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTAGT........................................................................................2112.0088.00-1.00---------------------------------------------------------1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................................................ATAAAGCAGAAAGCACTAAT........................................................................................2012.003.00----------1.00--------------------------------------------------1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................................................ATAAAGCAGAAAGCACTAAA........................................................................................2012.003.00-----1.00-------------------------------1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................................................TTTCATTATCCTTTCTTTCTCCTTTAG..................................................2712.002.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00----------1.00--------
............................................................................................................................................................................................................TTAAGATCCGCATTGAAGACCCACC.....................2512.002.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00-------------------------------------------------------------------1.00--------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACAACT........................................................................................2142.004.251.250.25-----------------------------0.25-----------------------------------------------------------------------------------0.25------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTGCTA.......................................................................................2212.001.00--1.00--------------------------1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................................................ATAAAGCAGAAAGCACCACT........................................................................................202.000.00-------1.00--1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCTCTA..........................................................................................192.000.00---------1.00---------------------1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACGACT........................................................................................2141.504.250.50------------------0.25--------------------------------------------------------------------------0.25-----------------------------------------------------------------------------------------------------------------0.25---------------------------------------------------------------------------------------------0.25-----
.............................................................................................................................................CATAAAGCAGAAAGCACC...........................................................................................1841.504.25---0.25-0.250.25----------------0.25-------0.25----------------------------------------------------------------------------------0.25-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCATCA..........................................................................................191.000.00-----1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................................................................................................................................................TTAAGATCCGCATTGAAG............................1811.001.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00------------------------------------------------------------------------------
..............................................................................................................................................ATAAAGCAGAAAGCACTAT.........................................................................................1911.003.00------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................................TAAAGCAGAAAGCACCACT........................................................................................191.000.00--------------1.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
......TGTGTGGTCTCCTAAACATGAGCTTTGG........................................................................................................................................................................................................................2811.001.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00--------------------
........................................................................................................................................................................................................................TTGAAGACCCACCCCGCAGAA.............2111.001.00------------------------------------------------------------------------------------------------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
...................................................................................................................................................................................................................CCGCATTGAAGACCCACCCCGC.................2211.001.00-----------1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................................................ATAAAGCAGAAAGCACGACA........................................................................................201.000.00---------------------------------------------------------------------------------1.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
...........................................................................................................................................TTCATAAAGCAGAAAGCACTAC.........................................................................................221.000.00-1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACGAC.........................................................................................2041.004.25--------0.50------0.25---------------0.25------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................................................ATAAAGCAGAAAGCACCAAT........................................................................................201.000.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00-------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................................................................TCATTATCCTTTCTTCCT.........................................................181.000.00-----------------------------------------------------------------------------------------------1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................................................ATAAAGCAGAAAGCACGAC.........................................................................................191.000.00----------1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................................................ATAAAGCAGAAAGCACTATTA.......................................................................................2111.003.00------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTG..........................................................................................1911.001.00------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................................................................AAAGCAGAAAGCACTACTA.......................................................................................191.000.00-1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
........................................................................................................................................................................TACCATTTCATTATCCTTTCTTTCTCCTTTAG..................................................3211.001.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00---------------
.............................................................................................................................................CATAAAGCAGAAAGCACTTT.........................................................................................2011.0088.00------------------------------------------------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................................................ATAAAGCAGAAAGCACTACCC.......................................................................................2111.003.00-------1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................................................................................TAAGATCCGCATTGAAGACCCACCCCG..................2711.001.00-----------1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................................................................................TAAGATCCGCATTGAAGACCCACC.....................2411.001.00-----------1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.......................................................................................................................................................................................................................ATTGAAGACCCACCCCGCAGAAAGCACA.......2811.001.00-----------------------------------------------------------------------------------------------1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
................................................................................................................................................................................................................GATCCGCATTGAAGACCCACCCCGCAGAAAGCA.........3311.001.00---------------------------------------------------------------------------------------------------------------------------------------------------------------1.00----------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTACTG.......................................................................................2211.0088.00--1.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTGCAA.......................................................................................2211.001.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00----------------------------------------------------------------------------------------------------------------------------
.....................................................................................................................................................................................................................GCATTGAAGACCCACCCCGCAGAAAA...........2611.001.00------------------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................................................................................................................................ATCCGCATTGAAGACCCACCCCGCA................2511.001.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00--------------
..............................................................................................................................................................................................................................ACCCACCCCGCAGAAAGCACA.......2111.001.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00-------------------------------------------------------
..............................................................................................................................................ATAAAGCAGAAAGCACTCCT........................................................................................2011.003.00-------------------------------------------------------------------------------------1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................................................ATAAAGCAGAAAGCACTTCTA.......................................................................................2111.003.00-1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................................TAAAGCAGAAAGCACTACTA.......................................................................................201.000.00--1.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
......................................................................................................................................................................................................................CATTGAAGACCCACCCCG..................1811.001.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00------------------------------------------------------------
..............................................................................................................................................ATAAAGCAGAAAGCACTACCA.......................................................................................2111.003.00---1.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
........................................................................................................................................................................................................AAATTTAAGATCCGCATTGAAGAA..........................241.000.00-------------------------------------------------------------------------------------------------------1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................................................ATAAAGCAGAAAGCACTAGC........................................................................................2011.003.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00-----------------------------------------------------------------------------------------------------------------------
..................................................................................................................................................................................................................TCCGCATTGAAGACCCAC......................1811.001.00------------------------------------------------------------------------------------------------------------------------------------------------------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................................TAAAGCAGAAAGCACTACT........................................................................................191.000.00----1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTCAA........................................................................................2111.0088.00-----1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCATT...........................................................................................181.000.00-----1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTGA.........................................................................................2011.001.00----------------------1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCTAC...........................................................................................181.000.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00-----------------------------------------------------------------------------------------------------------
...............................................................................................................................................................................................................................CCCACCCCGCAGAAAGCACATGG....2311.001.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00----------------------------------
...........................................................................................................................................................................................................................AAGACCCACCCCGCAGAAAGCACATGG....2711.001.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00-----------------------------------------------------
..................................................................................................................................................................................TTATCCTTTCTTTCTCCTCAG...................................................211.000.00-----------------------------------------------------------------------------------------------1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
...........................................................................................................................................................................................................................AAGACCCACCCCGCAGAAAG...........2011.001.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00--------------------------------------------
.............................................................................................................................................................................................................TAAGATCCGCATTGAAGACCCACCCCGCAGAA.............3211.001.00---------------------------------------------------------------------------------------------------------------------------------------------------------------1.00----------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................TGAGGGAGAGCATATAACAG.........................................................................................................................201.000.00------------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCATTAA.........................................................................................201.000.00-----1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTAATA.......................................................................................2211.0088.00-1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................................................ATAAAGCAGAAAGCACCACA........................................................................................201.000.00--------------------------------------------------------1.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTAAAG.......................................................................................2211.0088.00-----1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................................................ATAAAGCAGAAAGCACTACG........................................................................................2011.003.00----------------------------1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................................................................................................................................................TTAAGATCCGCATTG...............................1511.001.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00--------------------------------------------------------------------------
...............................................................................................................................................TAAAGCAGAAAGCACTATTA.......................................................................................201.000.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00--------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................................................ATAAAGCAGAAAGCACTATT........................................................................................2011.003.00------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.................................................................................................................................................................................................................................CACCCCGCAGAAAGCACATGG....2111.001.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00---------------------------------------------------------------------------------------------------------
.................................................................................................................................................................................................................................CACCCCGCAGAAAGCACATG.....2011.001.00--------------------------------------------------------------------------------------------------------------------------1.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTATAG.......................................................................................2211.0088.00------------------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................................................................................................................................................................AGACCCACCCCGCAGAAAGCACG.......231.000.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00--------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTTCCA.......................................................................................2211.0088.00-1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
..........................................................................................TACAGGACTGTTGCAAGTGTGG..........................................................................................................................................221.000.00-1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................................................................................TCATAAAGCAGAAAGCAC............................................................................................1811.001.00------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................................................ATAAAGCAGAAAGCACAA..........................................................................................181.000.00---------------1.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................................................................................................AGATCCGCATTGAAGACCC........................1911.001.00------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
...................................................................................................................................................................................................................CCGCATTGAAGACCCACC.....................1811.001.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00---------------------------
.................................................................................................................................................................................................................................CACCCCGCAGAAAGCACA.......1811.001.00------------------------------------------------------------------------------------------------------------------------------------------------------1.00-------------------------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................................TAAAGCAGAAAGCACTAC.........................................................................................181.000.00-------------1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTCCTC.......................................................................................2211.0088.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00----------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCAGTAA.........................................................................................201.000.00-----1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCTACT..........................................................................................191.000.001.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.....................................................................................................................................................................................................................GCATTGAAGACCCACCCCGCAGAAA............2511.001.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00---------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTCCC........................................................................................2111.0088.001.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
..............................................................................................................................................ATAAAGCAGAAAGCACTGCT........................................................................................201.000.00----------------------------------------------------------------------------------------------------1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTTA.........................................................................................2011.0088.00-----1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
........................................................................................................................................................................................................AAATTTAAGATCCGCATTGAAGACCC........................2611.001.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00-------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCAGTCA.........................................................................................201.000.00----------------------1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTCCGT.......................................................................................2211.0088.00-------------------------------------------------------------------------------------------1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTCAT........................................................................................2111.0088.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00---------------------------------------------------------------------------------------------------------------
..............................................................................................................................................ATAAAGCAGAAAGCACCACC........................................................................................201.000.00--1.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTCAAA.......................................................................................2211.0088.00-----------------------------------------------------------------------1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACTAAGA.......................................................................................2211.0088.00-------1.00------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
......................................................................................................................................................................................................................CATTGAAGACCCACCCCGCAGAAAGCACA.......2911.001.00-----------------------------------------------------------------------------------------------1.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
...............................................................................................................................................................................................................AGATCCGCATTGAAGACCCACCC....................2311.001.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00--------------------------------------------------------------------------------------------------------------------
..............................................................................................................................................ATAAAGCAGAAAGCACCAC.........................................................................................191.000.00--------1.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................................................................................................................................................TTAAGATCCGCATTGAAGACCCAC......................2411.001.00----------------------------------------------------------------------------1.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
............................................................................................................................................TCATAAAGCAGAAAGCACT...........................................................................................1911.001.00---------------1.00----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
........................................................................................................................................................................................................................TTGAAGACCCACCCCGCAGAAAGCACACGG....301.000.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00--------------------------------------------------------------------------------------------------------------------------------
........................................................................................................................................................................................................AAATTTAAGATCCGCATTGAAGACC.........................2511.001.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00-----------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACAA..........................................................................................1940.754.25--------0.25------------------------0.25------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------0.25---
.............................................................................................................................................CATAAAGCAGAAAGCACCAC.........................................................................................2040.504.25-0.25--------------------------0.25---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................................................................................................................................................CCCGCAGAAAGCACATG.....1720.500.50-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------0.50------
....................................................................................................................................................................................................................................CCCGCAGAAAGCACAT......1620.500.50------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------0.50-------
....................................................................................................................................................................................................................................CCCGCAGAAAGCACATGGT...1920.500.50---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------0.50----------------------------------------------------------------------------------------------------------
.....................................................................................................................................................................................................................................CCGCAGAAAGCACATG.....1620.500.50-------------------------0.50------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACCAT.........................................................................................2040.504.25----------------------------0.25-----0.25---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.....................................................................................................................................................................................................................................CCGCAGAAAGCACATGGT...1820.500.50----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------0.50---------------------------------------------------------------------------------------------------------
.........................................................................................................AGTTTGAGGGAGAGC..................................................................................................................................1590.440.44-----------------------------------------------------------------------------------------------0.22---------------------------------------------------0.22----------------------------------------------------------------------------------------------------------------------------------------------------------------
....................................................................................................................................................................................................................................CCCGCAGAAAGCACA.......1550.400.40------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------0.200.20
.............................................................................................................................................CATAAAGCAGAAAGCACCAA.........................................................................................2040.254.25-----0.25--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACAACC........................................................................................2140.254.250.25-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACCACC........................................................................................2140.254.25-0.25------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACCACA........................................................................................2140.254.25------------------------------------------0.25-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACGACG........................................................................................2140.254.25--------------------------------0.25-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACGC..........................................................................................1940.254.25---------0.25----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACGAAT........................................................................................2140.254.25-----------0.25--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACAAA.........................................................................................2040.254.25--------0.25-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACCTAA........................................................................................2140.254.25-----------------------------0.25--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACCAAT........................................................................................2140.254.25-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------0.25--
.............................................................................................................................................CATAAAGCAGAAAGCACAAC.........................................................................................2040.254.25-------------------------------------------0.25------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
.............................................................................................................................................CATAAAGCAGAAAGCACAAGT........................................................................................2140.254.25--0.25-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

Antisense strand
GATGGATGTGTGGTCTCCTAAACATGAGCTTTGGGCAAATTACTAAATGTTTCTGTACCTCAGGTACCAAATATTACGTTCTACTTATATTACAGGACTGTTGCAAGTTTGAGGGAGAGCATATATTTAAAAAGCCATTTTCATAAAGCAGAAAGCACTGTGCACATGTACCATTTCATTATCCTTTCTTTCTCCTTTAGAAATTTAAGATCCGCATTGAAGACCCACCCCGCAGAAAGCACATGGTATT
...............................................................................................................................................(((((.((((((....((((....))))................)))))).)))))...................................................
........................................................................................................................................137............................................................200................................................
SizePerfect hitTotal NormPerfect NormSRR387910(GSM843862)
antibody for ip: Ago2. (ago2 cell line)		SRR189787SRR189786SRR343334SRR343335SRR060986(GSM569190)
Human memory B cell [09-001]. (cell line)		SRR033721(GSM497066)
Ly3 cell line (Ly3). (B cell)		SRR033726(GSM497071)
Mututated CLL (CLLM633). (B cell)		TAX577740(Rovira)
total RNA. (breast)		SRR033725(GSM497070)
Unmutated CLL (CLLU626). (B cell)		SRR033723(GSM497068)
L1236 cell line (L1236). (B cell)		SRR060981(GSM569185)
Human centroblast [09-001]. (cell line)		SRR189784SRR343336SRR343337TAX577738(Rovira)
total RNA. (breast)		SRR033719(GSM497064)
6hr Activated B cell line (ABC158). (B cell)		SRR033720(GSM497065)
EBV activated B cell line (EBV159). (B cell)		SRR060982(GSM569186)
Human centrocyte [09-001]. (cell line)		SRR040010(GSM532895)
G529N. (cervix)		SRR033722(GSM497067)
KMS12 cell line (KMS12). (B cell)		SRR033714(GSM497059)
Burkitt Lymphoma (BL134). (B cell)		SRR060983(GSM569187)
Human pre-germinal center B cell [09-001]. (cell line)		TAX577739(Rovira)
total RNA. (breast)		SRR191570(GSM715680)
56genomic small RNA (size selected RNA from t. (breast)		DRR000556(DRX000314)
"THP-1 whole cell RNA, after 3 day treatment . (cell line)		SRR060984(GSM569188)
Human plasma cell [09-001]. (cell line)		SRR191475(GSM715585)
18genomic small RNA (size selected RNA from t. (breast)		TAX577744(Rovira)
total RNA. (breast)		SRR040015(GSM532900)
G623T. (cervix)		SRR040028(GSM532913)
G026N. (cervix)		TAX577743(Rovira)
total RNA. (breast)		SRR015361(GSM380326)
Memory B cells (MM55). (B cell)		SRR015358(GSM380323)
NaÌøve B Cell (Naive39). (B cell)		TAX577745(Rovira)
total RNA. (breast)		SRR191409(GSM715519)
19genomic small RNA (size selected RNA from t. (breast)		SRR033724(GSM497069)
L428 cell line (L428). (B cell)		SRR191404(GSM715514)
47genomic small RNA (size selected RNA from t. (breast)		SRR191625(GSM715735)
32genomic small RNA (size selected RNA from t. (breast)		SRR191615(GSM715725)
94genomic small RNA (size selected RNA from t. (breast)		SRR040018(GSM532903)
G701N. (cervix)		SRR191413(GSM715523)
28genomic small RNA (size selected RNA from t. (breast)		SRR060985(GSM569189)
Human naive B cell [09-001]. (cell line)		SRR191442(GSM715552)
107genomic small RNA (size selected RNA from . (breast)		SRR191410(GSM715520)
20genomic small RNA (size selected RNA from t. (breast)		SRR191598(GSM715708)
79genomic small RNA (size selected RNA from t. (breast)		SRR033710(GSM497055)
GCB DLBCL (GCB385). (B cell)		DRR000559(DRX000317)
"THP-1 whole cell RNA, no treatment". (cell line)		SRR033728(GSM497073)
MALT (MALT413). (B cell)		SRR191576(GSM715686)
86genomic small RNA (size selected RNA from t. (breast)		SRR191612(GSM715722)
65genomic small RNA (size selected RNA from t. (breast)		DRR000555(DRX000313)
"THP-1 whole cell RNA, no treatment". (cell line)		SRR191568(GSM715678)
51genomic small RNA (size selected RNA from t. (breast)		SRR033715(GSM497060)
Mantle Cell Lymphoma (Mino122). (B cell)		SRR191632(GSM715742)
78genomic small RNA (size selected RNA from t. (breast)		SRR040025(GSM532910)
G613T. (cervix)		SRR191551(GSM715661)
32genomic small RNA (size selected RNA from t. (breast)		SRR191396(GSM715506)
29genomic small RNA (size selected RNA from t. (breast)		SRR191406(GSM715516)
67genomic small RNA (size selected RNA from t. (breast)		SRR191423(GSM715533)
137genomic small RNA (size selected RNA from . (breast)		TAX577579(Rovira)
total RNA. (breast)		SRR191443(GSM715553)
108genomic small RNA (size selected RNA from . (breast)		SRR191412(GSM715522)
24genomic small RNA (size selected RNA from t. (breast)		GSM532878(GSM532878)
G691T. (cervix)		SRR015359(GSM380324)
Germinal Center B cell (GC136). (B cell)		DRR000561(DRX000319)
Isolation of RNA following immunoprecipitatio. (ago2 cell line)		SRR191397(GSM715507)
30genomic small RNA (size selected RNA from t. (breast)		SRR191573(GSM715683)
68genomic small RNA (size selected RNA from t. (breast)		DRR000558(DRX000316)
"THP-1 whole cell RNA, after 3 day treatment . (cell line)		SRR191565(GSM715675)
92genomic small RNA (size selected RNA from t. (breast)		SRR191458(GSM715568)
28genomic small RNA (size selected RNA from t. (breast)		SRR040027(GSM532912)
G220T. (cervix)		GSM532872(GSM532872)
G652T. (cervix)		DRR000557(DRX000315)
"THP-1 whole cell RNA, after 3 day treatment . (cell line)		SRR039637(GSM518474)
THP1_total_sRNAs. (cell line)		SRR033716(GSM497061)
Mentle Cell Lymphoma (MCL114). (B cell)		SRR033727(GSM497072)
HIV-positive DL (HIV412). (B cell)		SRR191417(GSM715527)
39genomic small RNA (size selected RNA from t. (breast)		SRR191564(GSM715674)
87genomic small RNA (size selected RNA from t. (breast)		SRR191455(GSM715565)
181genomic small RNA (size selected RNA from . (breast)		SRR387909(GSM843861)
specific-host: Homo sapienshost cell line: Su. (cell line)		SRR191433(GSM715543)
170genomic small RNA (size selected RNA from . (breast)		SRR191451(GSM715561)
177genomic small RNA (size selected RNA from . (breast)		SRR191614(GSM715724)
92genomic small RNA (size selected RNA from t. (breast)		SRR039191(GSM494810)
PBMCs were isolated by ficoll gradient from t. (blood)		SRR191469(GSM715579)
117genomic small RNA (size selected RNA from . (breast)		SRR191603(GSM715713)
71genomic small RNA (size selected RNA from t. (breast)		SRR191569(GSM715679)
54genomic small RNA (size selected RNA from t. (breast)		SRR191459(GSM715569)
32genomic small RNA (size selected RNA from t. (breast)		GSM450608(GSM450608)
miRNA sequencing raw reads from post-mortem s. (brain)		TAX577589(Rovira)
total RNA. (breast)		SRR191471(GSM715581)
119genomic small RNA (size selected RNA from . (breast)		SRR191601(GSM715711)
58genomic small RNA (size selected RNA from t. (breast)		SRR191394(GSM715504)
23genomic small RNA (size selected RNA from t. (breast)		SRR039193(GSM494812)
HL60 cell line is derived from acute promyelo. (cell line)		SRR189781(GSM714641)
cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)		SRR039625(GSM531988)
HBV(-) HCV(-) HCC Tissue Sample. (liver)		SRR191566(GSM715676)
94genomic small RNA (size selected RNA from t. (breast)		SRR033717(GSM497062)
Mentle Cell Lymphoma (MCL112). (B cell)		SRR191519(GSM715629)
86genomic small RNA (size selected RNA from t. (breast)		SRR191577(GSM715687)
93genomic small RNA (size selected RNA from t. (breast)		SRR191408(GSM715518)
88genomic small RNA (size selected RNA from t. (breast)		SRR191593(GSM715703)
62genomic small RNA (size selected RNA from t. (breast)		SRR191535(GSM715645)
181genomic small RNA (size selected RNA from . (breast)		SRR039192(GSM494811)
K562 cell line is derived from a CML patient . (cell line)		SRR040007(GSM532892)
G601T. (cervix)		GSM450602(GSM450602)
miRNA sequencing raw reads from post-mortem s. (brain)		SRR015360(GSM380325)
Plasma B cells (PC137). (B cell)		SRR191521(GSM715631)
92genomic small RNA (size selected RNA from t. (breast)		SRR191399(GSM715509)
36genomic small RNA (size selected RNA from t. (breast)		SRR191473(GSM715583)
121genomic small RNA (size selected RNA from . (breast)		SRR033729(GSM497074)
splenic MZL (Splenic414). (B cell)		SRR191545(GSM715655)
139genomic small RNA (size selected RNA from . (breast)		SRR015364(GSM380329)
Plasma B cells (PC44). (B cell)		TAX577741(Rovira)
total RNA. (breast)		SRR191439(GSM715549)
176genomic small RNA (size selected RNA from . (breast)		SRR191464(GSM715574)
112genomic small RNA (size selected RNA from . (breast)		SRR191574(GSM715684)
78genomic small RNA (size selected RNA from t. (breast)		SRR191575(GSM715685)
85genomic small RNA (size selected RNA from t. (breast)		SRR191587(GSM715697)
50genomic small RNA (size selected RNA from t. (breast)		SRR191428(GSM715538)
160genomic small RNA (size selected RNA from . (breast)		SRR191421(GSM715531)
122genomic small RNA (size selected RNA from . (breast)		SRR039620(GSM531983)
HBV(+) Adjacent Tissue Sample 2. (liver)		SRR191633(GSM715743)
85genomic small RNA (size selected RNA from t. (breast)		GSM450601(GSM450601)
miRNA sequencing raw reads from post-mortem s. (brain)		SRR191592(GSM715702)
59genomic small RNA (size selected RNA from t. (breast)		SRR191557(GSM715667)
57genomic small RNA (size selected RNA from t. (breast)		SRR191405(GSM715515)
55genomic small RNA (size selected RNA from t. (breast)		SRR191452(GSM715562)
178genomic small RNA (size selected RNA from . (breast)		SRR343333(GSM796036)
KSHV (HHV8). (cell line)		SRR040023(GSM532908)
G575T. (cervix)		SRR191621(GSM715731)
16genomic small RNA (size selected RNA from t. (breast)		SRR191629(GSM715739)
5genomic small RNA (size selected RNA from to. (breast)		SRR191626(GSM715736)
36genomic small RNA (size selected RNA from t. (breast)		SRR191620(GSM715730)
167genomic small RNA (size selected RNA from . (breast)		SRR191559(GSM715669)
65genomic small RNA (size selected RNA from t. (breast)		SRR191597(GSM715707)
75genomic small RNA (size selected RNA from t. (breast)		SRR191627(GSM715737)
45genomic small RNA (size selected RNA from t. (breast)		SRR191456(GSM715566)
182genomic small RNA (size selected RNA from . (breast)		SRR191624(GSM715734)
31genomic small RNA (size selected RNA from t. (breast)		SRR015365(GSM380330)
Memory B cells (MM139). (B cell)		SRR191560(GSM715670)
77genomic small RNA (size selected RNA from t. (breast)		SRR191438(GSM715548)
175genomic small RNA (size selected RNA from . (breast)		SRR191393(GSM715503)
22genomic small RNA (size selected RNA from t. (breast)		SRR191448(GSM715558)
143genomic small RNA (size selected RNA from . (breast)		SRR191402(GSM715512)
43genomic small RNA (size selected RNA from t. (breast)		SRR191622(GSM715732)
175genomic small RNA (size selected RNA from . (breast)		SRR444059(SRX128907)
Sample 17cDNABarcode: AF-PP-339: ACG CTC TTC . (skin)		RoviraIPAgo2(Rovira)
total RNA. (ago2 breast)		SRR033712(GSM497057)
Burkitt Lymphoma (BL510). (B cell)		SRR330905(SRX091743)
tissue: normal skindisease state: normal. (skin)		SRR191477(GSM715587)
2genomic small RNA (size selected RNA from to. (breast)		SRR191478(GSM715588)
30genomic small RNA (size selected RNA from t. (breast)		SRR037935(GSM510473)
293cand3. (cell line)		SRR191463(GSM715573)
111genomic small RNA (size selected RNA from . (breast)		DRR000562(DRX000320)
Isolation of RNA following immunoprecipitatio. (ago3 cell line)		SRR191604(GSM715714)
74genomic small RNA (size selected RNA from t. (breast)		SRR040019(GSM532904)
G701T. (cervix)		SRR191515(GSM715625)
4genomic small RNA (size selected RNA from to. (breast)		SRR553572(SRX182778)
source: Frontal Cortex. (Frontal Cortex)		SRR191508(GSM715618)
152genomic small RNA (size selected RNA from . (breast)		SRR191499(GSM715609)
6genomic small RNA (size selected RNA from to. (breast)		GSM450604(GSM450604)
miRNA sequencing raw reads from post-mortem s. (brain)		SRR191426(GSM715536)
149genomic small RNA (size selected RNA from . (breast)		SRR040016(GSM532901)
G645N. (cervix)		SRR191454(GSM715564)
180genomic small RNA (size selected RNA from . (breast)		SRR191465(GSM715575)
113genomic small RNA (size selected RNA from . (breast)		GSM450609(GSM450609)
miRNA sequencing raw reads from post-mortem s. (brain)		SRR191444(GSM715554)
109genomic small RNA (size selected RNA from . (breast)		SRR191489(GSM715599)
147genomic small RNA (size selected RNA from . (breast)		GSM1105753INPUT(GSM1105753)
small RNA sequencing data. (hela)		SRR191611(GSM715721)
57genomic small RNA (size selected RNA from t. (breast)		SRR191425(GSM715535)
141genomic small RNA (size selected RNA from . (breast)		SRR189782SRR191589(GSM715699)
69genomic small RNA (size selected RNA from t. (breast)		SRR191466(GSM715576)
114genomic small RNA (size selected RNA from . (breast)		SRR040031(GSM532916)
G013T. (cervix)		SRR191578(GSM715688)
100genomic small RNA (size selected RNA from . (breast)		SRR191403(GSM715513)
44genomic small RNA (size selected RNA from t. (breast)		SRR189779(GSM714639)
cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)		SRR040022(GSM532907)
G575N. (cervix)		SRR191546(GSM715656)
152genomic small RNA (size selected RNA from . (breast)		SRR191432(GSM715542)
169genomic small RNA (size selected RNA from . (breast)		SRR039635(GSM518472)
THP1_nuc_sRNAs. (cell line)		SRR033713(GSM497058)
Burkitt Lymphoma (BL115). (B cell)		SRR191415(GSM715525)
33genomic small RNA (size selected RNA from t. (breast)		SRR191429(GSM715539)
166genomic small RNA (size selected RNA from . (breast)		SRR444051(SRX128899)
Sample 11cDNABarcode: AF-PP-339: ACG CTC TTC . (skin)		SRR191474(GSM715584)
16genomic small RNA (size selected RNA from t. (breast)		SRR191461(GSM715571)
35genomic small RNA (size selected RNA from t. (breast)		SRR191414(GSM715524)
31genomic small RNA (size selected RNA from t. (breast)		SRR039622(GSM531985)
HCV(+) Adjacent Tissue Sample. (liver)		SRR191453(GSM715563)
179genomic small RNA (size selected RNA from . (breast)		SRR191623(GSM715733)
18genomic small RNA (size selected RNA from t. (breast)		TAX577453(Rovira)
total RNA. (breast)		SRR040035(GSM532920)
G001T. (cervix)		SRR191472(GSM715582)
120genomic small RNA (size selected RNA from . (breast)		GSM532885(GSM532885)
G850N. (cervix)		SRR191497(GSM715607)
17genomic small RNA (size selected RNA from t. (breast)		SRR444040(SRX128888)
Sample 1cDNABarcode: AF-PP-333: ACG CTC TTC C. (skin)		SRR033711(GSM497056)
GCB DLBCL (GCB110). (B cell)		SRR342899(SRX096795)
small RNA seq of Left atrial tissue. (heart)		SRR330890(SRX091728)
tissue: skin psoriatic uninvolveddisease stat. (skin)		SRR039616(GSM531979)
HBV(+) Distal Tissue Sample 1. (liver)		SRR015363(GSM380328)
Germinal Center B cell (GC40). (B cell)		SRR040011(GSM532896)
G529T. (cervix)		TAX577742(Rovira)
total RNA. (breast)		GSM450600(GSM450600)
miRNA sequencing raw reads from post-mortem s. (brain)		SRR191563(GSM715673)
83genomic small RNA (size selected RNA from t. (breast)		SRR191427(GSM715537)
153genomic small RNA (size selected RNA from . (breast)		SRR191520(GSM715630)
89genomic small RNA (size selected RNA from t. (breast)		SRR191605(GSM715715)
76genomic small RNA (size selected RNA from t. (breast)		SRR191398(GSM715508)
35genomic small RNA (size selected RNA from t. (breast)		SRR037942(GSM510480)
293DroshaTN_cand5. (cell line)		SRR191436(GSM715546)
173genomic small RNA (size selected RNA from . (breast)		SRR191420(GSM715530)
122genomic small RNA (size selected RNA from . (breast)		SRR033718(GSM497063)
Multiple Myeloma (U266). (B cell)		SRR191419(GSM715529)
41genomic small RNA (size selected RNA from t. (breast)		SRR037936(GSM510474)
293cand1. (cell line)		SRR191543(GSM715653)
124genomic small RNA (size selected RNA from . (breast)		SRR330857(SRX091695)
tissue: skin psoriatic involveddisease state:. (skin)		SRR191462(GSM715572)
1genomic small RNA (size selected RNA from to. (breast)		SRR039615(GSM531978)
Severe Chronic Hepatitis B Liver Tissue. (liver)		TAX577746(Rovira)
total RNA. (breast)		GSM450607(GSM450607)
miRNA sequencing raw reads from post-mortem s. (brain)		SRR094130(GSM651906)
small RNA(18-35nt)small RNA deep sequencing o. (uterus)		SRR330892(SRX091730)
tissue: skin psoriatic uninvolveddisease stat. (skin)		SRR191480(GSM715590)
38genomic small RNA (size selected RNA from t. (breast)		SRR191590(GSM715700)
48genomic small RNA (size selected RNA from t. (breast)		SRR207111(GSM721073)
Whole cell RNA. (cell line)		SRR444058(SRX128906)
Sample 16cDNABarcode: AF-PP-335: ACG CTC TTC . (skin)		SRR191476(GSM715586)
19genomic small RNA (size selected RNA from t. (breast)		SRR039618(GSM531981)
HBV(+) Side Tissue Sample 1. (liver)		SRR342901(SRX096797)
small RNA seq of Left atrial tissue. (heart)		SRR191509(GSM715619)
156genomic small RNA (size selected RNA from . (breast)		SRR040009(GSM532894)
G727T. (cervix)		SRR094131(GSM651907)
small RNA(18-35nt)small RNA deep sequencing o. (uterus)		SRR553573(SRX182779)
source: Cerebellum. (Cerebellum)		SRR191491(GSM715601)
150genomic small RNA (size selected RNA from . (breast)		GSM532874(GSM532874)
G699T. (cervix)		SRR207118(GSM721080)
RRP40 knockdown. (RRP40 cell line)		SRR191500(GSM715610)
7genomic small RNA (size selected RNA from to. (breast)		SRR191556(GSM715666)
45genomic small RNA (size selected RNA from t. (breast)		SRR040036(GSM532921)
G243N. (cervix)		SRR191494(GSM715604)
157genomic small RNA (size selected RNA from . (breast)		SRR040008(GSM532893)
G727N. (cervix)		SRR444048(SRX128896)
Sample 8cDNABarcode: AF-PP-333: ACG CTC TTC C. (skin)		SRR095854(SRX039177)
"miRNA were isolated from FirstChoice Human B. (brain)		SRR191503(GSM715613)
10genomic small RNA (size selected RNA from t. (breast)		SRR191418(GSM715528)
40genomic small RNA (size selected RNA from t. (breast)		SRR191523(GSM715633)
107genomic small RNA (size selected RNA from . (breast)		SRR191450(GSM715560)
145genomic small RNA (size selected RNA from . (breast)		SRR191594(GSM715704)
70genomic small RNA (size selected RNA from t. (breast)		SRR033732(GSM497077)
bjab cell line (bjab103). (B cell)		SRR189780(GSM714640)
cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)		SRR191416(GSM715526)
34genomic small RNA (size selected RNA from t. (breast)		SRR191498(GSM715608)
3genomic small RNA (size selected RNA from to. (breast)		SRR191617(GSM715727)
104genomic small RNA (size selected RNA from . (breast)		SRR330899(SRX091737)
tissue: skin psoriatic uninvolveddisease stat. (skin)		SRR191483(GSM715593)
11genomic small RNA (size selected RNA from t. (breast)		SRR191517(GSM715627)
75genomic small RNA (size selected RNA from t. (breast)		SRR191548(GSM715658)
101genomic small RNA (size selected RNA from . (breast)		SRR191524(GSM715634)
119genomic small RNA (size selected RNA from . (breast)		SRR330874(SRX091712)
tissue: skin psoriatic involveddisease state:. (skin)		SRR040033(GSM532918)
G603T. (cervix)		SRR040038(GSM532923)
G531N. (cervix)		SRR191502(GSM715612)
9genomic small RNA (size selected RNA from to. (breast)		SRR191595(GSM715705)
72genomic small RNA (size selected RNA from t. (breast)		SRR037940(GSM510478)
293cand5_rep2. (cell line)		SRR207115(GSM721077)
XRN1&2 knockdown. (XRN1/XRN2 cell line)		SRR191505(GSM715615)
139genomic small RNA (size selected RNA from . (breast)		SRR330870(SRX091708)
tissue: skin psoriatic involveddisease state:. (skin)		SRR191440(GSM715550)
26genomic small RNA (size selected RNA from t. (breast)		SRR330877(SRX091715)
tissue: skin psoriatic involveddisease state:. (skin)		SRR040032(GSM532917)
G603N. (cervix)		SRR191401(GSM715511)
38genomic small RNA (size selected RNA from t. (breast)		SRR191422(GSM715532)
129genomic small RNA (size selected RNA from . (breast)		SRR191602(GSM715712)
60genomic small RNA (size selected RNA from t. (breast)		SRR060169(GSM565979)
5-8F_cytoplasm. (cell line)		SRR330915(SRX091753)
tissue: normal skindisease state: normal. (skin)		GSM450599(GSM450599)
miRNA sequencing raw reads from post-mortem s. (brain)		SRR191582(GSM715692)
95genomic small RNA (size selected RNA from t. (breast)		SRR191526(GSM715636)
127genomic small RNA (size selected RNA from . (breast)		SRR191591(GSM715701)
53genomic small RNA (size selected RNA from t. (breast)		GSM450605(GSM450605)
miRNA sequencing raw reads from post-mortem s. (brain)		SRR444043(SRX128891)
Sample 4cDNABarcode: AF-PP-339: ACG CTC TTC C. (skin)		SRR039619(GSM531982)
HBV(+) HCC Tissue Sample 1. (liver)		SRR330866(SRX091704)
tissue: skin psoriatic involveddisease state:. (skin)		SRR330920(SRX091758)
tissue: normal skindisease state: normal. (skin)		DRR000560(DRX000318)
Isolation of RNA following immunoprecipitatio. (ago1 cell line)		SRR330876(SRX091714)
tissue: skin psoriatic involveddisease state:. (skin)		SRR191540(GSM715650)
62genomic small RNA (size selected RNA from t. (breast)		SRR189778(GSM714638)
cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)		SRR039623(GSM531986)
HCV(+) HCC Tissue Sample. (liver)		SRR033731(GSM497076)
h929 Cell line (h929). (B cell)		SRR191430(GSM715540)
167genomic small RNA (size selected RNA from . (breast)		SRR326281(GSM769511)
"Dicer mRNA was knocked down using siDicer, c. (cell line)		SRR330859(SRX091697)
tissue: skin psoriatic involveddisease state:. (skin)		SRR191479(GSM715589)
31genomic small RNA (size selected RNA from t. (breast)		SRR189777(GSM714637)
cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)		SRR330896(SRX091734)
tissue: skin psoriatic uninvolveddisease stat. (skin)		SRR330894(SRX091732)
tissue: skin psoriatic uninvolveddisease stat. (skin)		GSM450606(GSM450606)
miRNA sequencing raw reads from post-mortem s. (brain)		SRR191588(GSM715698)
52genomic small RNA (size selected RNA from t. (breast)		SRR191431(GSM715541)
168genomic small RNA (size selected RNA from . (breast)		SRR191446(GSM715556)
140genomic small RNA (size selected RNA from . (breast)		SRR330879(SRX091717)
tissue: skin psoriatic involveddisease state:. (skin)		SRR553576(SRX182782)
source: Testis. (testes)
.............................................................................................................................TTTAAAAAGCCATTTTCATAATG...................................................................................................... 232.000.00------------------------------------------------------------------------------------------------2.00-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
......................................................................ATATTACGTTCTACTTAG.................................................................................................................................................................. 181.000.00-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00--------------------------------------------------------------------------------------------------------------------------------------
........................................................................................................................................................................................................................................CAGAAAGCACATGGTTGC 181.000.00---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00----------------------------------------------------------------------
...............................................................................................................................................................................................................................CTTTCTGCGGGGTGGG........... 1611.001.00--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------1.00-----------