| (11) B-CELL | (2) BRAIN | (7) BREAST | (28) CELL-LINE | (4) CERVIX | (1) HEART | (6) LIVER | (2) OTHER | (3) SKIN | (2) UTERUS | (1) XRN.ip |
| GCCGTCACTCTTCATCAGCCTGGAATGCATTAGATTCAGGAAACATAAGTGCTCATCTTTTTTTCTCCCTTTAAAGTAGAGGATACCAAGATACAGTGAGGAATTAGCACAGCTCCCGCAGGGGAGGTGTGGGCAGGAAAGGAGGGCTGAGAAAGGAGTGGCCAGGGACTGTCTAACTGGATTCCTTCTGTTTCCTGCAGGTTGTACTCACATCATTGGTCTTATGGGGAAATTTTAAGACCTCCCACTT .....................................................................................((....................((((.(((((....))))).))))..(((..........))).....)).............................................................................................. ......................................................................71........................................................................................161....................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR015363(GSM380328) Germinal Center B cell (GC40). (B cell) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR343335 | SRR343334 | SRR038855(GSM458538) D10. (cell line) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR037937(GSM510475) 293cand2. (cell line) | SRR033718(GSM497063) Multiple Myeloma (U266). (B cell) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell) | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR015359(GSM380324) Germinal Center B cell (GC136). (B cell) | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | SRR444065(SRX128913) Sample 22cDNABarcode: AF-PP-335: ACG CTC TTC . (cell line) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | SRR038858(GSM458541) MEL202. (cell line) | SRR038859(GSM458542) MM386. (cell line) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR037934(GSM510472) 293cand4_rep3. (cell line) | SRR038853(GSM458536) MELB. (cell line) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR191574(GSM715684) 78genomic small RNA (size selected RNA from t. (breast) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR189784 | SRR191436(GSM715546) 173genomic small RNA (size selected RNA from . (breast) | SRR207117(GSM721079) Whole cell RNA. (cell line) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR040013(GSM532898) G648T. (cervix) | SRR039615(GSM531978) Severe Chronic Hepatitis B Liver Tissue. (liver) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR033724(GSM497069) L428 cell line (L428). (B cell) | GSM532874(GSM532874) G699T. (cervix) | SRR191631(GSM715741) 75genomic small RNA (size selected RNA from t. (breast) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR015447(SRR015447) nuclear small RNAs. (breast) | SRR038861(GSM458544) MM466. (cell line) | SRR040006(GSM532891) G601N. (cervix) | SRR015448(SRR015448) cytoplasmic small RNAs. (breast) | TAX577579(Rovira) total RNA. (breast) | SRR038860(GSM458543) MM426. (cell line) | SRR040032(GSM532917) G603N. (cervix) | SRR038863(GSM458546) MM603. (cell line) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | SRR029131(GSM416760) MCF7. (cell line) | SRR060986(GSM569190) Human memory B cell [09-001]. (cell line) | SRR189778(GSM714638) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | GSM450598(GSM450598) miRNA sequencing raw reads from post-mortem s. (brain) | SRR191550(GSM715660) 27genomic small RNA (size selected RNA from t. (breast) | SRR189777(GSM714637) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR038852(GSM458535) QF1160MB. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...........................................................................................................................................AGGAGGGCTGAGAAAAAA............................................................................................. | 18 | 57.00 | 0.00 | 9.00 | 6.00 | - | - | - | 1.00 | 2.00 | 3.00 | - | 2.00 | 3.00 | 1.00 | 3.00 | - | 1.00 | - | - | - | - | 1.00 | - | 2.00 | 1.00 | 2.00 | - | 2.00 | 1.00 | - | 1.00 | 1.00 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | 1.00 | - | - | 1.00 | - | 1.00 | - | - | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | - | 1.00 | 1.00 | - | 1.00 | 1.00 | - | - | 1.00 | - | - | 1.00 | |
| ...........................................................................................................................................AGGAGGGCTGAGAAAAAAA............................................................................................ | 19 | 43.00 | 0.00 | - | 3.00 | - | - | 3.00 | 3.00 | - | 1.00 | 4.00 | - | - | 2.00 | - | - | 2.00 | 2.00 | 2.00 | 2.00 | 2.00 | 1.00 | 2.00 | - | 1.00 | - | 2.00 | - | 1.00 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | |
| .........................................................................................................................................AAAGGAGGGCTGAGAGGA............................................................................................... | 18 | 3.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................GTAGAGGATACCAAGGCGC............................................................................................................................................................ | 19 | 2.00 | 0.00 | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................TGGGCAGGAAAGGAGGAGCT..................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................GTGGGCAGGAAAGGAGGAG....................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................AAGGAGGGCTGAGAAAAAA............................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................AGGAGGGCTGAGAAAAGAA............................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................AGGAGGGCTGAGAAAACAC............................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................GTGGGCAGGAAAGGAGGAGCT..................................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................GTAGAGGATACCAAGGTGT............................................................................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................AGGATACCAAGATACAACAG....................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................TCTTTTTTTCTCCCTTTAAATG............................................................................................................................................................................. | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | |
| ................................................................................................................................GTGGGCAGGAAAGGAGGAGC...................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................TGGGCAGGAAAGGAGGAG....................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................CTCATCTTTTTTTCTCCAG.................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | |
| ...........................................................................................................................................AGGAGGGCTGAGAAAAACA............................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................GGCAGGAAAGGAGGGC....................................................................................................... | 16 | 8 | 0.12 | 0.12 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.12 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| GCCGTCACTCTTCATCAGCCTGGAATGCATTAGATTCAGGAAACATAAGTGCTCATCTTTTTTTCTCCCTTTAAAGTAGAGGATACCAAGATACAGTGAGGAATTAGCACAGCTCCCGCAGGGGAGGTGTGGGCAGGAAAGGAGGGCTGAGAAAGGAGTGGCCAGGGACTGTCTAACTGGATTCCTTCTGTTTCCTGCAGGTTGTACTCACATCATTGGTCTTATGGGGAAATTTTAAGACCTCCCACTT .....................................................................................((....................((((.(((((....))))).))))..(((..........))).....)).............................................................................................. ......................................................................71........................................................................................161....................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR015363(GSM380328) Germinal Center B cell (GC40). (B cell) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR343335 | SRR343334 | SRR038855(GSM458538) D10. (cell line) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR037937(GSM510475) 293cand2. (cell line) | SRR033718(GSM497063) Multiple Myeloma (U266). (B cell) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell) | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR015359(GSM380324) Germinal Center B cell (GC136). (B cell) | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | SRR444065(SRX128913) Sample 22cDNABarcode: AF-PP-335: ACG CTC TTC . (cell line) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | SRR038858(GSM458541) MEL202. (cell line) | SRR038859(GSM458542) MM386. (cell line) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR037934(GSM510472) 293cand4_rep3. (cell line) | SRR038853(GSM458536) MELB. (cell line) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR191574(GSM715684) 78genomic small RNA (size selected RNA from t. (breast) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR189784 | SRR191436(GSM715546) 173genomic small RNA (size selected RNA from . (breast) | SRR207117(GSM721079) Whole cell RNA. (cell line) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR040013(GSM532898) G648T. (cervix) | SRR039615(GSM531978) Severe Chronic Hepatitis B Liver Tissue. (liver) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR033724(GSM497069) L428 cell line (L428). (B cell) | GSM532874(GSM532874) G699T. (cervix) | SRR191631(GSM715741) 75genomic small RNA (size selected RNA from t. (breast) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR015447(SRR015447) nuclear small RNAs. (breast) | SRR038861(GSM458544) MM466. (cell line) | SRR040006(GSM532891) G601N. (cervix) | SRR015448(SRR015448) cytoplasmic small RNAs. (breast) | TAX577579(Rovira) total RNA. (breast) | SRR038860(GSM458543) MM426. (cell line) | SRR040032(GSM532917) G603N. (cervix) | SRR038863(GSM458546) MM603. (cell line) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | SRR029131(GSM416760) MCF7. (cell line) | SRR060986(GSM569190) Human memory B cell [09-001]. (cell line) | SRR189778(GSM714638) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | GSM450598(GSM450598) miRNA sequencing raw reads from post-mortem s. (brain) | SRR191550(GSM715660) 27genomic small RNA (size selected RNA from t. (breast) | SRR189777(GSM714637) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR038852(GSM458535) QF1160MB. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...........................................................................................TACAGTGAGGAATTAACG............................................................................................................................................. | 18 | 16.00 | 0.00 | - | - | 9.00 | 7.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................................................TGTTTCCTGCAGGTTTCA............................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................................TTTCCTGCAGGTTGTGCT.......................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | |
| .................................................................................................................................................................CCAGGGACTGTCTAACA........................................................................ | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................AAACATAAGTGCTCATCT................................................................................................................................................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................CCTTCTGTTTCCTGCCTT................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................CTCCTTTCTCAGCCCTCCTTTCCTGC............................................................................................ | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................TGAGAAAGGAGTGGCCACTTC.................................................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................GAAACAGAAGGAATCCAG........................................................ | 18 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................................................................................AACCTGCAGGAAACAGAA............................................... | 18 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |