| (1) AGO2.ip | (3) B-CELL | (1) BRAIN | (7) BREAST | (6) CELL-LINE | (13) CERVIX | (3) HEART | (3) LIVER | (3) OTHER | (24) SKIN |
| GACAAGCCCGGCGCCTCTACGTGGGCAACATCCCCTTTGGCATCACTGAGGTACTGCCCTCCCCTGCCCCCTACCCTCTCCCTTGTCCCTCTACCCCGTTCCTCCCCTTCCCTCCATTCCCTTTCCCCAACCTGCACGGGTCAGACTCTGCTCCTGCAAGACCCCCCGGCCCCCTCCCAGACGGACCGATGGAGTTGAGCCAGCCAGGGGCCGGGCTGGGGGTGGCCCTCCCTCCCTCCTCTTCCCCTCT ...................................................................................................................................(((...(((((....(((((....))).))......))))).....)))...................................................................... ..............................................................................................................111......................................................................184................................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR040012(GSM532897) G648N. (cervix) | SRR040022(GSM532907) G575N. (cervix) | SRR314796(SRX084354) "Total RNA, fractionated (15-30nt)". (cell line) | SRR040032(GSM532917) G603N. (cervix) | SRR040020(GSM532905) G699N_2. (cervix) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | TAX577741(Rovira) total RNA. (breast) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189784 | GSM532889(GSM532889) G576N. (cervix) | SRR040040(GSM532925) G612N. (cervix) | SRR040016(GSM532901) G645N. (cervix) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR444062(SRX128910) Sample 27_3cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR060168(GSM565978) 5-8F_nucleus. (cell line) | GSM532887(GSM532887) G761N. (cervix) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR040034(GSM532919) G001N. (cervix) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | GSM532877(GSM532877) G691N. (cervix) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR444045(SRX128893) Sample 6cDNABarcode: AF-PP-341: ACG CTC TTC C. (skin) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR191554(GSM715664) 99genomic small RNA (size selected RNA from t. (breast) | SRR444059(SRX128907) Sample 17cDNABarcode: AF-PP-339: ACG CTC TTC . (skin) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191556(GSM715666) 45genomic small RNA (size selected RNA from t. (breast) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR040008(GSM532893) G727N. (cervix) | SRR444048(SRX128896) Sample 8cDNABarcode: AF-PP-333: ACG CTC TTC C. (skin) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040014(GSM532899) G623N. (cervix) | SRR444057(SRX128905) Sample 15cDNABarcode: AF-PP-334: ACG CTC TTC . (skin) | TAX577742(Rovira) total RNA. (breast) | SRR343335 | SRR191404(GSM715514) 47genomic small RNA (size selected RNA from t. (breast) | SRR189786 | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | GSM532879(GSM532879) G659N. (cervix) | SRR033714(GSM497059) Burkitt Lymphoma (BL134). (B cell) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR191596(GSM715706) 73genomic small RNA (size selected RNA from t. (breast) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .................................................................................................................................................................CCCCCCGGCCCCCTCCGCC...................................................................... | 19 | 18.00 | 0.00 | 6.00 | 1.00 | - | 3.00 | 1.00 | - | - | - | - | - | - | 2.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................CCCCCCGGCCCCCTCCGC....................................................................... | 18 | 15.00 | 0.00 | 6.00 | 2.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................CCCCCCGGCCCCCTCCGCCC..................................................................... | 20 | 8.00 | 0.00 | 2.00 | 1.00 | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................CCCCCGGCCCCCTCCGCC...................................................................... | 18 | 6.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | |
| ..................................................................................................................................................................CCCCCGGCCCCCTCCGC....................................................................... | 17 | 5.00 | 0.00 | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................CCCCCGGCCCCCTCCGCCC..................................................................... | 19 | 5.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................CCCCGGCCCCCTCCCTCTC.................................................................... | 19 | 4.00 | 0.00 | - | - | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................CCCCCCGGCCCCCTCCCCCC..................................................................... | 20 | 3.00 | 0.00 | 1.00 | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................CCCTTTGGCATCACTGAG........................................................................................................................................................................................................ | 18 | 1 | 3.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - |
| .............CCTCTACGTGGGCAACATC.......................................................................................................................................................................................................................... | 19 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................ACCCCGTTCCTCCCC............................................................................................................................................... | 15 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................CAACATCCCCTTTGGCATCACCG.......................................................................................................................................................................................................... | 23 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................AGACGGACCGATGGAGTTG..................................................... | 19 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............CTCTACGTGGGCAACATC.......................................................................................................................................................................................................................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................ACCCCCCGGCCCCCTCCCCCCC.................................................................... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................AGACTCTGCTCCTGCAAGAC........................................................................................ | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................ATTCCCTTTCCCCAACCTG.................................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................GCACGGGTCAGACTCTGAAA................................................................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................CCCCCCGGCCCCCTCCCACGGC................................................................... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | |
| ................................................................................................................................................................ACCCCCCGGCCCCCTCCGCCC..................................................................... | 21 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................CAACATCCCCTTTGGCATCACTG.......................................................................................................................................................................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................CCCCCCGGCCCCCTCCCCCCC.................................................................... | 21 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................TTTGGCATCACTGAGGAGG.................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | |
| ....................GTGGGCAACATCCCCTTTGGCATC.............................................................................................................................................................................................................. | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - |
| ...........................ACATCCCCTTTGGCATCACTGAG........................................................................................................................................................................................................ | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................CCCCCCGGCCCCCTCTGCC...................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | |
| .....................................................................................................................................................................................CGGACCGATGGAGTTGAGCCAGCCAGG.......................................... | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................CCCCCCGGCCCCCTCCGCCT..................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | |
| .........................................................................................................................................GGGTCAGACTCTGCTCCTGCAAGAC........................................................................................ | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................CCAACCTGCACGGGTCAG.......................................................................................................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - |
| ...............TCTACGTGGGCAACATCCCCTTTGGCATC.............................................................................................................................................................................................................. | 29 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................CCTCCCCTGCCCCCTACC............................................................................................................................................................................... | 18 | 5 | 0.40 | 0.40 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 |
| .....................................................................CCTACCCTCTCCCTTGT.................................................................................................................................................................... | 17 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| GACAAGCCCGGCGCCTCTACGTGGGCAACATCCCCTTTGGCATCACTGAGGTACTGCCCTCCCCTGCCCCCTACCCTCTCCCTTGTCCCTCTACCCCGTTCCTCCCCTTCCCTCCATTCCCTTTCCCCAACCTGCACGGGTCAGACTCTGCTCCTGCAAGACCCCCCGGCCCCCTCCCAGACGGACCGATGGAGTTGAGCCAGCCAGGGGCCGGGCTGGGGGTGGCCCTCCCTCCCTCCTCTTCCCCTCT ...................................................................................................................................(((...(((((....(((((....))).))......))))).....)))...................................................................... ..............................................................................................................111......................................................................184................................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR040012(GSM532897) G648N. (cervix) | SRR040022(GSM532907) G575N. (cervix) | SRR314796(SRX084354) "Total RNA, fractionated (15-30nt)". (cell line) | SRR040032(GSM532917) G603N. (cervix) | SRR040020(GSM532905) G699N_2. (cervix) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | TAX577741(Rovira) total RNA. (breast) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189784 | GSM532889(GSM532889) G576N. (cervix) | SRR040040(GSM532925) G612N. (cervix) | SRR040016(GSM532901) G645N. (cervix) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR444062(SRX128910) Sample 27_3cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR060168(GSM565978) 5-8F_nucleus. (cell line) | GSM532887(GSM532887) G761N. (cervix) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR040034(GSM532919) G001N. (cervix) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | GSM532877(GSM532877) G691N. (cervix) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR444045(SRX128893) Sample 6cDNABarcode: AF-PP-341: ACG CTC TTC C. (skin) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR191554(GSM715664) 99genomic small RNA (size selected RNA from t. (breast) | SRR444059(SRX128907) Sample 17cDNABarcode: AF-PP-339: ACG CTC TTC . (skin) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191556(GSM715666) 45genomic small RNA (size selected RNA from t. (breast) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR040008(GSM532893) G727N. (cervix) | SRR444048(SRX128896) Sample 8cDNABarcode: AF-PP-333: ACG CTC TTC C. (skin) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040014(GSM532899) G623N. (cervix) | SRR444057(SRX128905) Sample 15cDNABarcode: AF-PP-334: ACG CTC TTC . (skin) | TAX577742(Rovira) total RNA. (breast) | SRR343335 | SRR191404(GSM715514) 47genomic small RNA (size selected RNA from t. (breast) | SRR189786 | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | GSM532879(GSM532879) G659N. (cervix) | SRR033714(GSM497059) Burkitt Lymphoma (BL134). (B cell) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR191596(GSM715706) 73genomic small RNA (size selected RNA from t. (breast) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ....................................................................................................................................................................................................GAGCCAGCCAGGGGCGCCA................................... | 19 | 5.00 | 0.00 | - | - | - | - | - | 2.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................................GAGCCAGCCAGGGGCCGCCA.................................. | 20 | 4.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | |
| ....................................................................................................................................................................................................GAGCCAGCCAGGGGCCGGCCA................................. | 21 | 3.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................CCCTCTCCCTTGTCCCTCTAGC........................................................................................................................................................... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................CCTTGTCCCTCTACCCTAGA...................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................................GAGCCAGCCAGGGGCGCCC................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................................CCTCCCAGACGGACCGC............................................................. | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................AGGGTAGGGGGCAGGGGAGGGC............................................................................................................................................................................. | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................CAAGACCCCCCGGCCA.............................................................................. | 16 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................TACCCTCTCCCTTGTCTG................................................................................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |