| (3) AGO2.ip | (2) AGO3.ip | (3) B-CELL | (2) BRAIN | (9) BREAST | (13) CELL-LINE | (4) CERVIX | (1) FIBROBLAST | (5) HEART | (2) HELA | (1) KIDNEY | (4) LIVER | (1) OTHER | (20) SKIN |
| CGAGGTGGGAACCATGAACATCTTTGTCTACTGGACCCACGAAGATGGGGGTAAGCCCACCCATGACCCAGCCCGAACCCTGGTGGAAGTGGGTGGCACCATCATTCCTGGCAGGTTACAGGCCCCAGGGATTCTGGGATGGGGGAAGGGGGTGGCTCTTAAGACGGCGGTGCTAGGGGGTGAGAGGTAACATCTTCCACCCCTTACACCTGCCCTAGTGCTGGAGCTGGTGACGCCCCCGCTGAATGGTGTTATCCTGCCTGGAGTG .....................................................................................................................................................................(((((((.(((((((((.((((......))))))))))))))))).)))...................................................... ...............................................................................................................................................................160.......................................................218................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR189782 | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | GSM1105750AGO3(GSM1105750) small RNA sequencing data. (ago3 hela) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR343334 | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR189784 | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | TAX577744(Rovira) total RNA. (breast) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR037936(GSM510474) 293cand1. (cell line) | SRR191598(GSM715708) 79genomic small RNA (size selected RNA from t. (breast) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | DRR000561(DRX000319) Isolation of RNA following immunoprecipitatio. (ago2 cell line) | SRR037935(GSM510473) 293cand3. (cell line) | TAX577588(Rovira) total RNA. (breast) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR040010(GSM532895) G529N. (cervix) | DRR000562(DRX000320) Isolation of RNA following immunoprecipitatio. (ago3 cell line) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR189787 | GSM532880(GSM532880) G659T. (cervix) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR343333(GSM796036) KSHV (HHV8). (cell line) | SRR191459(GSM715569) 32genomic small RNA (size selected RNA from t. (breast) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR040008(GSM532893) G727N. (cervix) | SRR363675(GSM830252) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR191580(GSM715690) 103genomic small RNA (size selected RNA from . (breast) | GSM450603(GSM450603) miRNA sequencing raw reads from post-mortem s. (brain) | TAX577741(Rovira) total RNA. (breast) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040014(GSM532899) G623N. (cervix) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line) | SRR191547(GSM715657) 155genomic small RNA (size selected RNA from . (breast) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | DRR000559(DRX000317) "THP-1 whole cell RNA, no treatment". (cell line) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR343335 | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | TAX577738(Rovira) total RNA. (breast) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR029131(GSM416760) MCF7. (cell line) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR033729(GSM497074) splenic MZL (Splenic414). (B cell) | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...................................................................................................................................................................................................TCCACCCCTTACACCTGCCCTAG.................................................. | 23 | 1 | 21.00 | 21.00 | 3.00 | 2.00 | - | 1.00 | 1.00 | - | 1.00 | - | - | 1.00 | 1.00 | - | - | - | - | 1.00 | 1.00 | 2.00 | - | - | 1.00 | - | 1.00 | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................TCCACCCCTTACACCTGCCCTA................................................... | 22 | 1 | 15.00 | 15.00 | - | - | 1.00 | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | 2.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | 1.00 | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - |
| ...................................................................................................................................................................................................TCCACCCCTTACACCTGCCCTAA.................................................. | 23 | 1 | 7.00 | 15.00 | - | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................TCCACCCCTTACACCTGCCCTAT.................................................. | 23 | 1 | 5.00 | 15.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - |
| ...................................................................................................................................................................................................TCCACCCCTTACACCTGCCCTAGT................................................. | 24 | 1 | 5.00 | 5.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................TCCACCCCTTACACCTGCCCTT................................................... | 22 | 1 | 5.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - |
| ...................................................................................................................................................................................................TCCACCCCTTACACCTGCCCTAGA................................................. | 24 | 1 | 3.00 | 21.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - |
| .......................................................................................................................................................................CGGTGCTAGGGGGTGA..................................................................................... | 16 | 1 | 3.00 | 3.00 | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................TTTGTCTACTGGACCCACGAAGATGG............................................................................................................................................................................................................................ | 26 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................TCCACCCCTTACACCTGCCCCA................................................... | 22 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................................................CACCCCTTACACCTGCCCTATA................................................. | 22 | 2.00 | 0.00 | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................................TCCACCCCTTACACCTGCCC..................................................... | 20 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................ATCTTTGTCTACTGGACCCACGAAGATGGGG.......................................................................................................................................................................................................................... | 31 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................TCCACCCCTTACACCTGCCCT.................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - |
| .....................CTTTGTCTACTGGACCCACGAAGATG............................................................................................................................................................................................................................. | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .GAGGTGGGAACCATGAA.......................................................................................................................................................................................................................................................... | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................................................CACCCCTTACACCTGCCCCA................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................................................................................CTGGAGCTGGTGACGCCCCCGC.......................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................CTACTGGACCCACGAAGATGG............................................................................................................................................................................................................................ | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................TCCACCCCTTACACCTGCCCATT.................................................. | 23 | 1 | 1.00 | 2.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................................TAGGGGGTGAGAGGTACC............................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................CGGCGGTGCTAGGGGGTGAGAGTT................................................................................ | 24 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................................TCCACCCCTTACACCTGCCCGA................................................... | 22 | 1 | 1.00 | 2.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................ATGGGGGAAGGGGGTGTTTC.............................................................................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................................TCTTCCACCCCTTACACCTGC....................................................... | 21 | 1 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................................CCACCCCTTACACCTGCCCCTT.................................................. | 22 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................ACTGGACCCACGAAGAT.............................................................................................................................................................................................................................. | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................TCCACCCCTTACACCTGCCCTACA................................................. | 24 | 1 | 1.00 | 15.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................TTGTCTACTGGACCCACGAAGATGG............................................................................................................................................................................................................................ | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................................CCACCCCTTACACCTGCCCTAG.................................................. | 22 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....GTGGGAACCATGAACTCTG..................................................................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................................TCCACCCCTTACACCTGCCCATA.................................................. | 23 | 1 | 1.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................................TAACATCTTCCACCCCTTACACCTGCCCCAG.................................................. | 31 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................................................................................CTGGAGCTGGTGACGCCCCCGCTGAATGGTGC................ | 32 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................GGATGGGGGAAGGGGACC.................................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................AACCCTGGTGGAAGTGGG............................................................................................................................................................................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............TGAACATCTTTGTCTACTGG.......................................................................................................................................................................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................GGGGGAAGGGGGTGGAAAA............................................................................................................. | 19 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................GACGGCGGTGCTAGGGGGTGA..................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................ATCTTTGTCTACTGGACCCACGAAG................................................................................................................................................................................................................................ | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................TTGTCTACTGGACCCACGAAGATGGGG.......................................................................................................................................................................................................................... | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 |
| ...................................................................................................................................................................................................TCCACCCCTTACACCTGCCCTTA.................................................. | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................TCCACCCCTTACACCTGCCCCAG.................................................. | 23 | 1 | 1.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................TCCACCCCTTACACCTGCCCTTT.................................................. | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................TCTTTGTCTACTGGACCCATT................................................................................................................................................................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................CCACGAAGATGGGGGT........................................................................................................................................................................................................................ | 16 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................................................................................CTGAATGGTGTTATC............ | 15 | 7 | 0.14 | 0.14 | - | - | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| CGAGGTGGGAACCATGAACATCTTTGTCTACTGGACCCACGAAGATGGGGGTAAGCCCACCCATGACCCAGCCCGAACCCTGGTGGAAGTGGGTGGCACCATCATTCCTGGCAGGTTACAGGCCCCAGGGATTCTGGGATGGGGGAAGGGGGTGGCTCTTAAGACGGCGGTGCTAGGGGGTGAGAGGTAACATCTTCCACCCCTTACACCTGCCCTAGTGCTGGAGCTGGTGACGCCCCCGCTGAATGGTGTTATCCTGCCTGGAGTG .....................................................................................................................................................................(((((((.(((((((((.((((......))))))))))))))))).)))...................................................... ...............................................................................................................................................................160.......................................................218................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR189782 | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | GSM1105750AGO3(GSM1105750) small RNA sequencing data. (ago3 hela) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR343334 | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR189784 | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | TAX577744(Rovira) total RNA. (breast) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR037936(GSM510474) 293cand1. (cell line) | SRR191598(GSM715708) 79genomic small RNA (size selected RNA from t. (breast) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | DRR000561(DRX000319) Isolation of RNA following immunoprecipitatio. (ago2 cell line) | SRR037935(GSM510473) 293cand3. (cell line) | TAX577588(Rovira) total RNA. (breast) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR040010(GSM532895) G529N. (cervix) | DRR000562(DRX000320) Isolation of RNA following immunoprecipitatio. (ago3 cell line) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR189787 | GSM532880(GSM532880) G659T. (cervix) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR343333(GSM796036) KSHV (HHV8). (cell line) | SRR191459(GSM715569) 32genomic small RNA (size selected RNA from t. (breast) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR040008(GSM532893) G727N. (cervix) | SRR363675(GSM830252) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR191580(GSM715690) 103genomic small RNA (size selected RNA from . (breast) | GSM450603(GSM450603) miRNA sequencing raw reads from post-mortem s. (brain) | TAX577741(Rovira) total RNA. (breast) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040014(GSM532899) G623N. (cervix) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line) | SRR191547(GSM715657) 155genomic small RNA (size selected RNA from . (breast) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | DRR000559(DRX000317) "THP-1 whole cell RNA, no treatment". (cell line) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR343335 | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | TAX577738(Rovira) total RNA. (breast) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR029131(GSM416760) MCF7. (cell line) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR033729(GSM497074) splenic MZL (Splenic414). (B cell) | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ........................................................................................................TTCCTGGCAGGTTACACGGC................................................................................................................................................ | 20 | 3.00 | 0.00 | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................................................................................GTGGAAGATGTTACC.................................................................... | 15 | 7 | 0.14 | 0.14 | - | - | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |