| (1) AGO2.ip | (1) B-CELL | (2) BREAST | (7) CELL-LINE | (2) CERVIX | (1) FIBROBLAST | (4) HEART | (1) HELA | (1) LIVER | (1) OTHER | (64) SKIN | (1) TESTES |
| CGGTGGGCGGTCCCGCCTCCATCTTCAGTTCCCGCATGGGGGCGAGGCAGGTACATGGGCCTTGCGGGCTGTGGGTGAAATTCCATTATTAATTGTTTTTTCACTAACCTGGTGGGGGAGTCGGGCGCGAGTTTCGAGAGAGACTCTGGCTTCTGGCGCCAAGCCTTAGCCAAGCTCACCAGGGGCAGCGCTAGATGGGGAGACTGGGACACACGTCTGAACGCAGATGTCCGAAGGGAGCGCAGGAAGA ...............................................................................................((((..((((.....))))..))))..((((..(((((((....))))))).(((.......)))..)))).................................................................................... .........................................................................................90..............................................................................170.............................................................................. | Size | Perfect hit | Total Norm | Perfect Norm | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR314796(SRX084354) "Total RNA, fractionated (15-30nt)". (cell line) | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189784 | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033729(GSM497074) splenic MZL (Splenic414). (B cell) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040028(GSM532913) G026N. (cervix) | SRR040036(GSM532921) G243N. (cervix) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR330875(SRX091713) tissue: skin psoriatic involveddisease state:. (skin) | GSM956925F181A(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (cell line) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR060169(GSM565979) 5-8F_cytoplasm. (cell line) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553576(SRX182782) source: Testis. (testes) | SRR444042(SRX128890) Sample 3cDNABarcode: AF-PP-335: ACG CTC TTC C. (skin) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR444048(SRX128896) Sample 8cDNABarcode: AF-PP-333: ACG CTC TTC C. (skin) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR444052(SRX128900) Sample 12cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR037940(GSM510478) 293cand5_rep2. (cell line) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR191460(GSM715570) 33genomic small RNA (size selected RNA from t. (breast) | SRR363674(GSM830251) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330882(SRX091720) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .....................................................................................................................................................CTTCTGGCGCCAAGC...................................................................................... | 15 | 2 | 94.00 | 94.00 | 3.00 | 5.00 | 7.00 | 5.00 | 5.00 | 5.00 | 3.00 | 3.00 | 4.50 | 2.50 | 4.00 | 0.50 | - | 0.50 | 2.50 | 1.50 | 2.50 | 2.00 | 1.50 | 2.00 | 1.50 | 0.50 | - | 1.00 | 1.00 | 2.50 | 2.00 | 2.00 | 1.00 | 0.50 | 1.50 | 1.50 | - | 0.50 | 1.50 | 1.00 | - | 1.00 | 1.00 | 1.00 | 1.00 | 1.50 | - | 0.50 | - | - | - | 0.50 | 0.50 | - | - | - | 0.50 | 0.50 | - | - | - | 0.50 | 1.00 | - | - | 0.50 | - | 0.50 | 0.50 | 0.50 | - | 0.50 | 0.50 | - | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 | - | - | - | - | - | - | 0.50 | 0.50 | - | - | - |
| ....................................................................................................................................................GCTTCTGGCGCCAAGC...................................................................................... | 16 | 2 | 57.50 | 57.50 | 5.50 | 3.00 | 1.00 | 2.00 | 1.50 | 2.00 | 2.50 | 2.00 | 1.00 | - | 0.50 | 2.50 | - | 3.00 | 0.50 | 1.00 | 0.50 | 1.00 | 1.50 | 1.00 | 1.50 | 2.00 | - | 1.50 | 1.50 | - | 0.50 | 0.50 | 1.50 | 1.50 | 0.50 | - | - | 1.50 | 0.50 | 0.50 | - | 0.50 | 0.50 | 0.50 | 0.50 | - | - | 0.50 | 1.00 | 1.00 | 0.50 | 0.50 | 0.50 | - | 1.00 | - | 0.50 | 0.50 | - | - | - | 0.50 | - | - | 1.00 | 0.50 | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | 0.50 | 0.50 | - | - | - | - | - | - | - |
| ....................................................................................................................................................GCTTCTGGCGCCAAG....................................................................................... | 15 | 4 | 12.00 | 12.00 | 0.50 | 0.25 | 0.75 | 0.50 | - | 0.25 | 1.00 | 0.50 | 0.25 | 0.50 | - | 0.25 | - | 0.25 | - | - | 0.25 | 0.25 | 0.25 | 0.25 | 0.25 | 0.50 | - | 0.50 | 0.25 | - | - | - | - | - | 0.25 | 0.25 | - | - | - | 0.50 | - | 0.25 | 0.25 | - | - | - | 0.25 | 0.25 | 0.25 | 0.25 | 0.25 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | 0.25 | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - |
| ..............................................................................................GTTTTTTCACTAACCCGG.......................................................................................................................................... | 18 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................GTTTTTTCACTAACCCG........................................................................................................................................... | 17 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................GCTTCTGGCGCCAAGATC.................................................................................... | 18 | 4 | 1.50 | 12.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................CTTCTGGCGCCAAGCGATC.................................................................................. | 19 | 2 | 1.50 | 94.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................GTTTTTTCACTAACCCGC.......................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................CTGGCTTCTGGCGCCAAGCGCC................................................................................... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................CCTTGCGGGCTGTGGGTG............................................................................................................................................................................. | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................CGCCAAGCCTTAGCCAGGG........................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................CTGGTGGGGGAGTCGTACT........................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................GGCTTCTGGCGCCAAGCGC.................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................CTGGTGGGGGAGTCGTACG........................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................GCTTCTGGCGCCAAGCCCC................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................TTTCGAGAGAGACTCCCG..................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................................................................................ACGCAGATGTCCGAAGGGGGG......... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................TGAAATTCCATTATTCCT............................................................................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................GTTTTTTCACTAACCCAGT......................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................CTTCTGGCGCCAAGCCCCGG................................................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................CTTCTGGCGCCAAGCCCC................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................GCATGGGGGCGAGGCGCTA...................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................................................................................CGCAGATGTCCGAAGGGGGAA........ | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................CTTCTGGCGCCAAGCTCCC.................................................................................. | 19 | 2 | 0.50 | 94.00 | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................AGCCAAGCTCACCAGGG.................................................................. | 17 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................CTTCTGGCGCCAAGCGGC................................................................................... | 18 | 2 | 0.50 | 94.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................GCTTCTGGCGCCAAGCGT.................................................................................... | 18 | 2 | 0.50 | 57.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................GCTTCTGGCGCCAAGCGCCA.................................................................................. | 20 | 2 | 0.50 | 57.50 | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................CTTCTGGCGCCAAGCGCA................................................................................... | 18 | 2 | 0.50 | 94.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - |
| ....................................................................................................................................................GCTTCTGGCGCCAAGCT..................................................................................... | 17 | 2 | 0.50 | 57.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................GCTTCTGGCGCCAAGCACCC.................................................................................. | 20 | 2 | 0.50 | 57.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................GCTTCTGGCGCCAAGCGCCG.................................................................................. | 20 | 2 | 0.50 | 57.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - |
| ....................................................................................................................................................GCTTCTGGCGCCAAGCA..................................................................................... | 17 | 2 | 0.50 | 57.50 | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................GCTTCTGGCGCCAAGCACG................................................................................... | 19 | 2 | 0.50 | 57.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - |
| ...............................................................................................................................................CTCTGGCTTCTGGCG............................................................................................ | 15 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................GCTTCTGGCGCCAAGAT..................................................................................... | 17 | 4 | 0.25 | 12.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................CCATTATTAATTGTTT........................................................................................................................................................ | 16 | 6 | 0.17 | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 |
| CGGTGGGCGGTCCCGCCTCCATCTTCAGTTCCCGCATGGGGGCGAGGCAGGTACATGGGCCTTGCGGGCTGTGGGTGAAATTCCATTATTAATTGTTTTTTCACTAACCTGGTGGGGGAGTCGGGCGCGAGTTTCGAGAGAGACTCTGGCTTCTGGCGCCAAGCCTTAGCCAAGCTCACCAGGGGCAGCGCTAGATGGGGAGACTGGGACACACGTCTGAACGCAGATGTCCGAAGGGAGCGCAGGAAGA ...............................................................................................((((..((((.....))))..))))..((((..(((((((....))))))).(((.......)))..)))).................................................................................... .........................................................................................90..............................................................................170.............................................................................. | Size | Perfect hit | Total Norm | Perfect Norm | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR314796(SRX084354) "Total RNA, fractionated (15-30nt)". (cell line) | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189784 | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033729(GSM497074) splenic MZL (Splenic414). (B cell) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040028(GSM532913) G026N. (cervix) | SRR040036(GSM532921) G243N. (cervix) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR330875(SRX091713) tissue: skin psoriatic involveddisease state:. (skin) | GSM956925F181A(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (cell line) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR060169(GSM565979) 5-8F_cytoplasm. (cell line) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553576(SRX182782) source: Testis. (testes) | SRR444042(SRX128890) Sample 3cDNABarcode: AF-PP-335: ACG CTC TTC C. (skin) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR444048(SRX128896) Sample 8cDNABarcode: AF-PP-333: ACG CTC TTC C. (skin) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR444052(SRX128900) Sample 12cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR037940(GSM510478) 293cand5_rep2. (cell line) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR191460(GSM715570) 33genomic small RNA (size selected RNA from t. (breast) | SRR363674(GSM830251) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330882(SRX091720) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .........................................................................................................AACCTGGTGGGGGAGCCC............................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................GCGGGAACTGAAGAT....................................................................................................................................................................................................................... | 15 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |