| (1) AGO1.ip | (1) AGO1.ip OTHER.mut | (2) AGO2.ip | (1) AGO3.ip | (12) B-CELL | (5) BRAIN | (4) BREAST | (21) CELL-LINE | (1) CERVIX | (1) HEART | (2) HELA | (5) LIVER | (3) OTHER | (6) SKIN | (1) XRN.ip |
| GTTCGGTCTTGCACGTGGCCGCTACCTACGGGCTCCCAGGAGTTCTCTTGGTATGGCCAGCTGGCAGGCAGGGGTTTGTCTGGGGGGTAGACTGGTTGCCCAGATTTTGGCTTCCAGGGCCAGGAGGCCAGGGGATACCCTTACCCAGCAGTCTGCCTTCTCTTCCTCCCAGGCTGTGCTTAACTCTGGGGTCCAGGTTGACCTGGAAGCCAGAGACTTCGA ...............................................................................((((((((((((((.((((.........((((((((.......))))))))(((....))).....))))))))))))).........))))).................................................. .........................................................................74................................................................................................172................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR039615(GSM531978) Severe Chronic Hepatitis B Liver Tissue. (liver) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR015361(GSM380326) Memory B cells (MM55). (B cell) | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | SRR060984(GSM569188) Human plasma cell [09-001]. (cell line) | GSM450610(GSM450610) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | SRR039191(GSM494810) PBMCs were isolated by ficoll gradient from t. (blood) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell) | SRR038858(GSM458541) MEL202. (cell line) | SRR207114(GSM721076) "IP against AGO 1 & 2, RRP40 knockdown". (ago1/2 RRP40 cell line) | SRR038861(GSM458544) MM466. (cell line) | SRR033715(GSM497060) Mantle Cell Lymphoma (Mino122). (B cell) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | GSM1105748AGO1(GSM1105748) small RNA sequencing data. (ago1 hela) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | SRR191607(GSM715717) 192genomic small RNA (size selected RNA from . (breast) | SRR039618(GSM531981) HBV(+) Side Tissue Sample 1. (liver) | GSM339995(GSM339995) hues6NP. (cell line) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR033716(GSM497061) Mentle Cell Lymphoma (MCL114). (B cell) | SRR038855(GSM458538) D10. (cell line) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR033726(GSM497071) Mututated CLL (CLLM633). (B cell) | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR038854(GSM458537) MM653. (cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR038857(GSM458540) D20. (cell line) | GSM1105750AGO3(GSM1105750) small RNA sequencing data. (ago3 hela) | TAX577589(Rovira) total RNA. (breast) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | SRR060986(GSM569190) Human memory B cell [09-001]. (cell line) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | GSM532886(GSM532886) G850T. (cervix) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | GSM450598(GSM450598) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033729(GSM497074) splenic MZL (Splenic414). (B cell) | SRR038852(GSM458535) QF1160MB. (cell line) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | SRR060169(GSM565979) 5-8F_cytoplasm. (cell line) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR343332(GSM796035) "KSHV (HHV8), EBV (HHV-4)". (cell line) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | TAX577741(Rovira) total RNA. (breast) | DRR000559(DRX000317) "THP-1 whole cell RNA, no treatment". (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..............................................................................TCTGGGGGGTAGACTGGTTGC........................................................................................................................... | 21 | 1 | 12.00 | 12.00 | - | - | - | 3.00 | 1.00 | - | 1.00 | 3.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................TCTGGGGGGTAGACTGGTTGCC.......................................................................................................................... | 22 | 1 | 10.00 | 10.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................TCTGGGGGGTAGACTGGTTGA........................................................................................................................... | 21 | 1 | 5.00 | 5.00 | - | - | - | - | 2.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................TCTGGGGGGTAGACTGGTTG............................................................................................................................ | 20 | 1 | 5.00 | 5.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................TCTGGGGGGTAGACTGGTTA............................................................................................................................ | 20 | 1 | 4.00 | 3.00 | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................TCTGGGGGGTAGACTGGTTGT........................................................................................................................... | 21 | 1 | 4.00 | 5.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................TCTGGGGGGTAGACTGGTT............................................................................................................................. | 19 | 1 | 3.00 | 3.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................TCTGGGGGGTAGACTGGTTGCAT......................................................................................................................... | 23 | 1 | 3.00 | 12.00 | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................TCTGGGGGGTAGACTGGTTGCCT......................................................................................................................... | 23 | 1 | 2.00 | 10.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................TCTGGGGGGTAGACTGGTTGTA.......................................................................................................................... | 22 | 1 | 2.00 | 5.00 | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................TCTGGGGGGTAGACTGGTTGAAAA........................................................................................................................ | 24 | 1 | 2.00 | 5.00 | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................TCTGGGGGGTAGACTGGTTGCCAAA....................................................................................................................... | 25 | 1 | 1.00 | 10.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................TCTGGGGGGTAGACTGGTTGAT.......................................................................................................................... | 22 | 1 | 1.00 | 5.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................TCTGGGGGGTAGACTGGTTAA........................................................................................................................... | 21 | 1 | 1.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................TCTGGGGGGTAGACTGGTTGCAA......................................................................................................................... | 23 | 1 | 1.00 | 12.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................CCAGGCTGTGCTTAACTCTGGGGTCCAGGTT....................... | 31 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................TCTGGGGGGTAGACTGGTTGCCA......................................................................................................................... | 23 | 1 | 1.00 | 10.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................TCCCAGGCTGTGCTTAACTCTG.................................. | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................TCTGGGGGGTAGACTGGCTT............................................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................TCTGGGGGGTAGACTGGTTAT........................................................................................................................... | 21 | 1 | 1.00 | 3.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................TCTGGGGGGTAGACTGGTTGCCAA........................................................................................................................ | 24 | 1 | 1.00 | 10.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................................GTTGACCTGGAAGCCAGAGACTTC.. | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................................GTCCAGGTTGACCTGGAA.............. | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................................GACCTGGAAGCCAGAGAC..... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................CTGGGGGGTAGACTGGTTGCC.......................................................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................CTGCCTTCTCTTCCTCCCAGG................................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................................CAGGTTGACCTGGAAGCCAGAGAC..... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................TCTGGGGGGTAGACTGGTA............................................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................TCTGGGGGGTAGACTGGTTGCCTTAT...................................................................................................................... | 26 | 1 | 1.00 | 10.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................CTGGGGGGTAGACTGGTTGCCAA........................................................................................................................ | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................TCTGGGGGGTAGACTGGTTGG........................................................................................................................... | 21 | 1 | 1.00 | 5.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................TCTGGGGGGTAGACTGGTTGCA.......................................................................................................................... | 22 | 1 | 1.00 | 12.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................TCTGGGGGGTAGACTGGTTGAAA......................................................................................................................... | 23 | 1 | 1.00 | 5.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................................GTTGACCTGGAAGCC........... | 15 | 9 | 0.11 | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 |
| GTTCGGTCTTGCACGTGGCCGCTACCTACGGGCTCCCAGGAGTTCTCTTGGTATGGCCAGCTGGCAGGCAGGGGTTTGTCTGGGGGGTAGACTGGTTGCCCAGATTTTGGCTTCCAGGGCCAGGAGGCCAGGGGATACCCTTACCCAGCAGTCTGCCTTCTCTTCCTCCCAGGCTGTGCTTAACTCTGGGGTCCAGGTTGACCTGGAAGCCAGAGACTTCGA ...............................................................................((((((((((((((.((((.........((((((((.......))))))))(((....))).....))))))))))))).........))))).................................................. .........................................................................74................................................................................................172................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR039615(GSM531978) Severe Chronic Hepatitis B Liver Tissue. (liver) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR015361(GSM380326) Memory B cells (MM55). (B cell) | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | SRR060984(GSM569188) Human plasma cell [09-001]. (cell line) | GSM450610(GSM450610) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | SRR039191(GSM494810) PBMCs were isolated by ficoll gradient from t. (blood) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell) | SRR038858(GSM458541) MEL202. (cell line) | SRR207114(GSM721076) "IP against AGO 1 & 2, RRP40 knockdown". (ago1/2 RRP40 cell line) | SRR038861(GSM458544) MM466. (cell line) | SRR033715(GSM497060) Mantle Cell Lymphoma (Mino122). (B cell) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | GSM1105748AGO1(GSM1105748) small RNA sequencing data. (ago1 hela) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | SRR191607(GSM715717) 192genomic small RNA (size selected RNA from . (breast) | SRR039618(GSM531981) HBV(+) Side Tissue Sample 1. (liver) | GSM339995(GSM339995) hues6NP. (cell line) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR033716(GSM497061) Mentle Cell Lymphoma (MCL114). (B cell) | SRR038855(GSM458538) D10. (cell line) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR033726(GSM497071) Mututated CLL (CLLM633). (B cell) | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR038854(GSM458537) MM653. (cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR038857(GSM458540) D20. (cell line) | GSM1105750AGO3(GSM1105750) small RNA sequencing data. (ago3 hela) | TAX577589(Rovira) total RNA. (breast) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | SRR060986(GSM569190) Human memory B cell [09-001]. (cell line) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | GSM532886(GSM532886) G850T. (cervix) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | GSM450598(GSM450598) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033729(GSM497074) splenic MZL (Splenic414). (B cell) | SRR038852(GSM458535) QF1160MB. (cell line) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | SRR060169(GSM565979) 5-8F_cytoplasm. (cell line) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR343332(GSM796035) "KSHV (HHV8), EBV (HHV-4)". (cell line) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | TAX577741(Rovira) total RNA. (breast) | DRR000559(DRX000317) "THP-1 whole cell RNA, no treatment". (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ......................................................................................................................................................GAGGAAGAGAAGGCAGAC...................................................... | 18 | 2 | 1.50 | 1.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | 0.50 | 0.50 | - | - | - | - | - | - |
| ........................................................................GGTTTGTCTGGGGGGTA..................................................................................................................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................ACGGGCTCCCAGGAGC................................................................................................................................................................................... | 16 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................GCTTCCAGGGCCAGGACTC.............................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................................GTCCAGGTTGACCTGGA............... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................GTTCTCTTGGTATGGGTG................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................CCTTACCCAGCAGTCTCGG................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................AGGAAGAGAAGGCAGACT....................................................... | 18 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................AGTCTGCCTTCTCTTCCTATA.................................................... | 21 | 0.33 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | |
| ..........................................................................TACCCCCCAGACAAA..................................................................................................................................... | 15 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - |
| .............................................................................................................CTCCTGGCCCTGGAAGC................................................................................................ | 17 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - |
| ..........................................................................TTTGTCTGGGGGGTAAAAA................................................................................................................................. | 19 | 0.25 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | |
| .......................................................................................................................................................GGAGGAAGAGAAGGCAGA..................................................... | 18 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 | - |