| (14) B-CELL | (1) BRAIN | (7) BREAST | (30) CELL-LINE | (1) HEART | (4) HELA | (4) LIVER | (1) OTHER | (1) RRP40.ip | (11) SKIN | (1) XRN.ip |
| TCATTTTGCAGCAGCATGTGGTGCGGGCTGAGAGCAGGTGCCCAGCATCCTCGCAGGCGTCAGCGTAGGAGGCGCCTCAACGTGGCCAGGGCAGCGCCTCCATGGTCTGAGCCAGCGCTGTGATGCTGCCGAGCGCTGTGATGCTGCCGAGCACTAGGGCCTAGACCACGCAGGGCTCAAGCCTGTCCCTTCCCTTGCAGCCGCCAGAGCAGCCACCCTACCCGCACCACCAGGGCGGCCCACCCCACTG ..................................................................................................(((.(((((((.(((...((......)).((((.((((......)).)))).)).....))).)))))))....)))........................................................................... .................................................................................................98...............................................................................179..................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR037937(GSM510475) 293cand2. (cell line) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR060168(GSM565978) 5-8F_nucleus. (cell line) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line) | TAX577743(Rovira) total RNA. (breast) | SRR037936(GSM510474) 293cand1. (cell line) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR189785 | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR037931(GSM510469) 293GFP. (cell line) | SRR033732(GSM497077) bjab cell line (bjab103). (B cell) | SRR038859(GSM458542) MM386. (cell line) | DRR001486(DRX001040) "Hela long cytoplasmic cell fraction, LNA(+)". (hela) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR033731(GSM497076) h929 Cell line (h929). (B cell) | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR029124(GSM416753) HeLa. (hela) | SRR191555(GSM715665) 195genomic small RNA (size selected RNA from . (breast) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR037935(GSM510473) 293cand3. (cell line) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR039615(GSM531978) Severe Chronic Hepatitis B Liver Tissue. (liver) | TAX577746(Rovira) total RNA. (breast) | SRR191508(GSM715618) 152genomic small RNA (size selected RNA from . (breast) | SRR029129(GSM416758) SW480. (cell line) | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR037943(GSM510481) 293DcrTN. (cell line) | SRR033724(GSM497069) L428 cell line (L428). (B cell) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR191556(GSM715666) 45genomic small RNA (size selected RNA from t. (breast) | SRR343333(GSM796036) KSHV (HHV8). (cell line) | GSM416733(GSM416733) HEK293. (cell line) | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell) | SRR095854(SRX039177) "miRNA were isolated from FirstChoice Human B. (brain) | SRR038861(GSM458544) MM466. (cell line) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR038860(GSM458543) MM426. (cell line) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR037934(GSM510472) 293cand4_rep3. (cell line) | SRR037939(GSM510477) 293cand5_rep1. (cell line) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | TAX577738(Rovira) total RNA. (breast) | SRR033714(GSM497059) Burkitt Lymphoma (BL134). (B cell) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR037933(GSM510471) 293cand4_rep2. (cell line) | SRR191550(GSM715660) 27genomic small RNA (size selected RNA from t. (breast) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR039611(GSM531974) Human Normal Liver Tissue Sample 1. (liver) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ......................................................................................................TGGTCTGAGCCAGCGCTGTGATGCT........................................................................................................................... | 25 | 1 | 97.00 | 97.00 | 12.00 | 4.00 | 12.00 | 3.00 | - | 6.00 | - | - | - | 3.00 | 3.00 | 3.00 | - | 2.00 | 3.00 | 3.00 | 1.00 | 1.00 | 1.00 | 2.00 | 1.00 | 2.00 | 1.00 | - | 2.00 | 2.00 | 2.00 | 2.00 | - | - | 2.00 | 2.00 | - | - | - | 1.00 | - | - | 1.00 | 1.00 | 1.00 | - | 1.00 | 1.00 | 1.00 | - | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | - | - | 1.00 | 1.00 | - | 1.00 | 1.00 | 1.00 | - | - | 1.00 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - |
| ..........................................................................................................................................TGATGCTGCCGAGCACTAGGGCCTAGAC.................................................................................... | 28 | 1 | 8.00 | 8.00 | - | 8.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................ATGGTCTGAGCCAGCGCTGTGATGCT........................................................................................................................... | 26 | 1 | 8.00 | 8.00 | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - |
| ......................................................................................................TGGTCTGAGCCAGCGCTGTGAT.............................................................................................................................. | 22 | 1 | 7.00 | 7.00 | - | - | - | - | - | - | 5.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................TGGTCTGAGCCAGCGCTGTGATGC............................................................................................................................ | 24 | 1 | 5.00 | 5.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................TGGTCTGAGCCAGCGCTGTGATGCTG.......................................................................................................................... | 26 | 1 | 5.00 | 5.00 | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - |
| .......................................................................................................GGTCTGAGCCAGCGCTGTGATGC............................................................................................................................ | 23 | 1 | 4.00 | 4.00 | - | - | - | 1.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................TCTGAGCCAGCGCTGTGATGCT........................................................................................................................... | 22 | 1 | 3.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................TGGTCTGAGCCAGCGCTGTGATG............................................................................................................................. | 23 | 1 | 3.00 | 3.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................TGTGATGCTGCCGAGAG................................................................................................................... | 17 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................TGCTGCCGAGCACTAGGGCCTAGACCACGCAGGGCTCAAGCCTGTCCCTTCCCTTGCA................................................... | 58 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................GGTCTGAGCCAGCGCTGTGATGCT........................................................................................................................... | 24 | 1 | 2.00 | 2.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - |
| .......................................................................................................................................................CACTAGGGCCTAGACCACGCAGGG........................................................................... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - |
| ..............................AGAGCAGGTGCCCAGCATCC........................................................................................................................................................................................................ | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................ATGGTCTGAGCCAGCGCTGTGAT.............................................................................................................................. | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................TGTGGTGCGGGCTGAGAGCTCTG................................................................................................................................................................................................................... | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................................CCACGCAGGGCTCAAGC.................................................................... | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................CGAGCACTAGGGCCTAGAC.................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................ATGGTCTGAGCCAGCGCTG.................................................................................................................................. | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................GTCTGAGCCAGCGCTGTGATGCT........................................................................................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................................................................ACCAGGGCGGCCCACCA..... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................ATGGTCTGAGCCAGCGCTGTGA............................................................................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................CATGGTCTGAGCCAGCGCTGTGATGCT........................................................................................................................... | 27 | 1 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................................................................GCACCACCAGGGCGGCGGCG....... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................TCTGAGCCAGCGCTGTGATGCTG.......................................................................................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - |
| ..............................................................................................................................................................................................................................CGCACCACCAGGGCGGCC.......... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................TGGTCTGAGCCAGCGCTG.................................................................................................................................. | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................TGGTCTGAGCCAGCGCTGTGATTCTG.......................................................................................................................... | 26 | 1 | 1.00 | 7.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...TTTTGCAGCAGCATGTGTTG................................................................................................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........AGCAGCATGTGGTGCGGGCCGAG.......................................................................................................................................................................................................................... | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................GCGGGCTGAGAGCAGTCGA................................................................................................................................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TGCCGAGCGCTGTGATG........................................................................................................... | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................AGAGCAGGTGCCCAGCATCCTCGCAGGCGCC............................................................................................................................................................................................. | 31 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................CCATGGTCTGAGCCAGCGCTGTGATGCT........................................................................................................................... | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................................................................ACCCGCACCACCAGGGCGGCCCACCCCA... | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................................................................GCACCACCAGGGCGGGG.......... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................TGGTCTGAGCCAGCGCTGTGATGCG........................................................................................................................... | 25 | 1 | 1.00 | 5.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................TGTCCCTTCCCTTGCA................................................... | 16 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 |
| TCATTTTGCAGCAGCATGTGGTGCGGGCTGAGAGCAGGTGCCCAGCATCCTCGCAGGCGTCAGCGTAGGAGGCGCCTCAACGTGGCCAGGGCAGCGCCTCCATGGTCTGAGCCAGCGCTGTGATGCTGCCGAGCGCTGTGATGCTGCCGAGCACTAGGGCCTAGACCACGCAGGGCTCAAGCCTGTCCCTTCCCTTGCAGCCGCCAGAGCAGCCACCCTACCCGCACCACCAGGGCGGCCCACCCCACTG ..................................................................................................(((.(((((((.(((...((......)).((((.((((......)).)))).)).....))).)))))))....)))........................................................................... .................................................................................................98...............................................................................179..................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR037937(GSM510475) 293cand2. (cell line) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR060168(GSM565978) 5-8F_nucleus. (cell line) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line) | TAX577743(Rovira) total RNA. (breast) | SRR037936(GSM510474) 293cand1. (cell line) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR189785 | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR037931(GSM510469) 293GFP. (cell line) | SRR033732(GSM497077) bjab cell line (bjab103). (B cell) | SRR038859(GSM458542) MM386. (cell line) | DRR001486(DRX001040) "Hela long cytoplasmic cell fraction, LNA(+)". (hela) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR033731(GSM497076) h929 Cell line (h929). (B cell) | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR029124(GSM416753) HeLa. (hela) | SRR191555(GSM715665) 195genomic small RNA (size selected RNA from . (breast) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR037935(GSM510473) 293cand3. (cell line) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR039615(GSM531978) Severe Chronic Hepatitis B Liver Tissue. (liver) | TAX577746(Rovira) total RNA. (breast) | SRR191508(GSM715618) 152genomic small RNA (size selected RNA from . (breast) | SRR029129(GSM416758) SW480. (cell line) | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR037943(GSM510481) 293DcrTN. (cell line) | SRR033724(GSM497069) L428 cell line (L428). (B cell) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR191556(GSM715666) 45genomic small RNA (size selected RNA from t. (breast) | SRR343333(GSM796036) KSHV (HHV8). (cell line) | GSM416733(GSM416733) HEK293. (cell line) | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell) | SRR095854(SRX039177) "miRNA were isolated from FirstChoice Human B. (brain) | SRR038861(GSM458544) MM466. (cell line) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR038860(GSM458543) MM426. (cell line) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR037934(GSM510472) 293cand4_rep3. (cell line) | SRR037939(GSM510477) 293cand5_rep1. (cell line) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | TAX577738(Rovira) total RNA. (breast) | SRR033714(GSM497059) Burkitt Lymphoma (BL134). (B cell) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR037933(GSM510471) 293cand4_rep2. (cell line) | SRR191550(GSM715660) 27genomic small RNA (size selected RNA from t. (breast) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR039611(GSM531974) Human Normal Liver Tissue Sample 1. (liver) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .....................................................................................................................................................................................CCTGTCCCTTCCCTTGAAA.................................................. | 19 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................................................TCTGGCGGCTGCAAGGGAAGGG.......................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................CTCAAGCCTGTCCCTGAAT........................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | |
| ......................................CGAGGATGCTGGGCA..................................................................................................................................................................................................... | 15 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - |