| (1)  BRAIN  | (2)  BREAST  | (21)  CELL-LINE  | (2)  CERVIX  | (2)  HEART  | (3)  LIVER  | (3)  OTHER  | (21)  SKIN  | 
| CACTCCAGCCTGGGTGCCAGAGCAACTCCATCTCAAAAAATAAAAATAAAAAATAAAGTGGGCTCCAGTTTCCCAGGTGCTTGGGGGTGGGCAGGTTGGAGGCCAGAGATGGCTTCTACATCTTGACAGCAGGCAGGCTTCGAAGTGCTGGCATTCAGATGTGTCTCCTGCTGTTTCTGATTTACTGTCCCCCACCCCAGTTCATCGAAGCCCGGCTGGAGAAGCTCAACAAGGGGGAGGGCTTCTCAGA .........................................................((..((((((..(((((((....)))))))))).((((.(((((((((....)))))))))...))))..)))..)).................................................................................................................... .........................................................58................................................................................140............................................................................................................  | Size | Perfect hit | Total Norm | Perfect Norm | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)  | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin)  | GSM450598(GSM450598) miRNA sequencing raw reads from post-mortem s. (brain)  | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)  | SRR189778(GSM714638) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)  | SRR189777(GSM714637) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)  | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin)  | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)  | SRR038854(GSM458537) MM653. (cell line)  | SRR189784 | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin)  | SRR189775(GSM714635) cell line: HEK293clip variant: CLIPenzymatic . (cell line)  | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR189776(GSM714636) cell line: HEK293clip variant: CLIPenzymatic . (cell line)  | SRR038852(GSM458535) QF1160MB. (cell line)  | SRR038859(GSM458542) MM386. (cell line)  | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin)  | SRR314796(SRX084354) "Total RNA, fractionated (15-30nt)". (cell line)  | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin)  | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart)  | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line)  | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR037937(GSM510475) 293cand2. (cell line)  | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver)  | TAX577741(Rovira) total RNA. (breast)  | SRR040039(GSM532924) G531T. (cervix)  | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR040012(GSM532897) G648N. (cervix)  | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver)  | SRR207116(GSM721078) Nuclear RNA. (cell line)  | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line)  | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin)  | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin)  | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line)  | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin)  | SRR038858(GSM458541) MEL202. (cell line)  | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin)  | SRR038857(GSM458540) D20. (cell line)  | SRR038853(GSM458536) MELB. (cell line)  | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver)  | SRR343335 | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin)  | SRR343336 | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin)  | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin)  | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR038861(GSM458544) MM466. (cell line)  | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart)  | SRR038856(GSM458539) D11. (cell line)  | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin)  | TAX577743(Rovira) total RNA. (breast)  | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin)  | 
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ......................................................................................................................CATCTTGACAGCAGGACG.................................................................................................................. | 18 | 13.00 | 0.00 | - | - | 6.00 | - | - | - | - | - | 3.00 | - | - | - | 1.00 | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................TACATCTTGACAGCAGGACG.................................................................................................................. | 20 | 2 | 13.00 | 4.50 | - | 2.00 | 3.50 | - | - | - | 1.50 | - | 0.50 | - | - | - | - | - | 1.00 | 1.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | 0.50 | 0.50 | 0.50 | 0.50 | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ....................................................................................................................TACATCTTGACAGCAG...................................................................................................................... | 16 | 3 | 9.00 | 9.00 | - | 3.00 | - | - | - | - | 0.67 | - | - | - | 1.33 | - | 1.33 | - | - | - | 0.33 | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | 0.67 | - | - | - | - | - | - | - | - | - | 0.33 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | 
| ....................................................................................................................TACATCTTGACAGCAGG..................................................................................................................... | 17 | 2 | 4.50 | 4.50 | - | 1.50 | - | - | - | - | 1.00 | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ....................................................................................................................TACATCTTGACAGCAGGACGG................................................................................................................. | 21 | 2 | 3.00 | 4.50 | 0.50 | 1.00 | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .....................................................................................................................ACATCTTGACAGCAGG..................................................................................................................... | 16 | 5 | 2.80 | 2.80 | - | 1.00 | - | - | - | - | 0.40 | - | - | - | 0.20 | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.40 | - | - | - | 0.20 | 0.20 | - | - | - | 0.20 | - | - | - | - | 
| .....................................................................................................................ACATCTTGACAGCAGGACG.................................................................................................................. | 19 | 5 | 2.60 | 2.80 | - | 0.80 | 0.60 | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | 0.20 | 0.20 | 0.20 | - | 
| ..............................................................CTCCAGTTTCCCAGGAAT.......................................................................................................................................................................... | 18 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................ACTCCATCTCAAAAAATAACG............................................................................................................................................................................................................. | 21 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................CATCTTGACAGCAGGACGG................................................................................................................. | 19 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................TACATCTTGACAGCAGATC................................................................................................................... | 19 | 3 | 1.33 | 9.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ............................................................................................................................................................................................................TCGAAGCCCGGCTGGAGAAGCTC....................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ....................................................................................................................TACATCTTGACAGCAGGAC................................................................................................................... | 19 | 2 | 1.00 | 4.50 | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ........CCTGGGTGCCAGAGCGGG................................................................................................................................................................................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................ACATCTTGACAGCAGGACGG................................................................................................................. | 20 | 5 | 1.00 | 2.80 | - | 0.20 | - | - | - | - | 0.20 | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | 0.20 | - | - | - | - | - | - | 
| ....................................................................................GGGTGGGCAGGTTGGATTT................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................ACTCCATCTCAAAAAATAAACAAG.......................................................................................................................................................................................................... | 24 | 1.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................ACATCTTGACAGCAGGA.................................................................................................................... | 17 | 5 | 0.40 | 2.80 | - | 0.40 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ................................................................................................................................................................................................................AGCCCGGCTGGAGAA........................... | 15 | 5 | 0.20 | 0.20 | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..............................................................................................................................................................................................CCCACCCCAGTTCATC............................................ | 16 | 8 | 0.12 | 0.12 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.12 | 
| CACTCCAGCCTGGGTGCCAGAGCAACTCCATCTCAAAAAATAAAAATAAAAAATAAAGTGGGCTCCAGTTTCCCAGGTGCTTGGGGGTGGGCAGGTTGGAGGCCAGAGATGGCTTCTACATCTTGACAGCAGGCAGGCTTCGAAGTGCTGGCATTCAGATGTGTCTCCTGCTGTTTCTGATTTACTGTCCCCCACCCCAGTTCATCGAAGCCCGGCTGGAGAAGCTCAACAAGGGGGAGGGCTTCTCAGA .........................................................((..((((((..(((((((....)))))))))).((((.(((((((((....)))))))))...))))..)))..)).................................................................................................................... .........................................................58................................................................................140............................................................................................................  | Size | Perfect hit | Total Norm | Perfect Norm | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)  | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin)  | GSM450598(GSM450598) miRNA sequencing raw reads from post-mortem s. (brain)  | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)  | SRR189778(GSM714638) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)  | SRR189777(GSM714637) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)  | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin)  | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)  | SRR038854(GSM458537) MM653. (cell line)  | SRR189784 | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin)  | SRR189775(GSM714635) cell line: HEK293clip variant: CLIPenzymatic . (cell line)  | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR189776(GSM714636) cell line: HEK293clip variant: CLIPenzymatic . (cell line)  | SRR038852(GSM458535) QF1160MB. (cell line)  | SRR038859(GSM458542) MM386. (cell line)  | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin)  | SRR314796(SRX084354) "Total RNA, fractionated (15-30nt)". (cell line)  | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin)  | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart)  | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line)  | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR037937(GSM510475) 293cand2. (cell line)  | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver)  | TAX577741(Rovira) total RNA. (breast)  | SRR040039(GSM532924) G531T. (cervix)  | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR040012(GSM532897) G648N. (cervix)  | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver)  | SRR207116(GSM721078) Nuclear RNA. (cell line)  | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line)  | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin)  | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin)  | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line)  | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin)  | SRR038858(GSM458541) MEL202. (cell line)  | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin)  | SRR038857(GSM458540) D20. (cell line)  | SRR038853(GSM458536) MELB. (cell line)  | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver)  | SRR343335 | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin)  | SRR343336 | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin)  | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin)  | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR038861(GSM458544) MM466. (cell line)  | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart)  | SRR038856(GSM458539) D11. (cell line)  | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin)  | TAX577743(Rovira) total RNA. (breast)  | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin)  | 
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .....................................AAATAAAAATAAAAAATAAAGTACT............................................................................................................................................................................................ | 25 | 6.00 | 0.00 | - | - | - | - | - | 5.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................AAAAAATAAAAATAAAAAATCTGC................................................................................................................................................................................................ | 24 | 6.00 | 0.00 | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................AAAAATAAAAATAAAAAATAAAGTGGGATG......................................................................................................................................................................................... | 30 | 2.50 | 0.00 | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................AAAAAATAAAAATAAAAAATAAACGGG............................................................................................................................................................................................. | 27 | 2.00 | 0.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................AAAAATAAAAAATAAAGTCTTG........................................................................................................................................................................................... | 22 | 2.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................CCATCTCAAAAAATAAAAATGGCC....................................................................................................................................................................................................... | 24 | 2.00 | 0.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................AAAAATAAAAATAAAAAATAAAGTGGAG........................................................................................................................................................................................... | 28 | 2.00 | 0.00 | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................CAAAAAATAAAAATAAAAAATCGGG................................................................................................................................................................................................ | 25 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................AAAAAATAAAAATAAAAAATAAAGTTTTG........................................................................................................................................................................................... | 29 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................ATAAAAAATAAAGTGATCC.......................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................AAAAATAAAAATAAAAAATAAAGTCTG............................................................................................................................................................................................ | 27 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................AAAAATAAAAATAAAAAATAAAGTAA............................................................................................................................................................................................. | 26 | 1.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................AAAAATAAAAATAAAAAATAAAGTGGG............................................................................................................................................................................................ | 27 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................AAAAAATAAAAATAAAAAATCAGG................................................................................................................................................................................................ | 24 | 1.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................CTGCCTGCTGTCAAGAT.................................................................................................................. | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ........................................TAAAAATAAAAAATAAAGTGCCG........................................................................................................................................................................................... | 23 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................GTGCTTGGGGGTGGGCAAGC.......................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................AAAAAATAAAAATAAAAAATAACGGG.............................................................................................................................................................................................. | 26 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................ATAAAAATAAAAAATAAAGTCTTG........................................................................................................................................................................................... | 24 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................................................................................................TCATCGAAGCCCGGCGGGG.............................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..TCTGGCACCCAGGCTGGAG..................................................................................................................................................................................................................................... | 19 | 0 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ...........................................AAATAAAAAATAAAGTGGAAAG......................................................................................................................................................................................... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................AAAAAATAAAAATAAAAAATAACTCG.............................................................................................................................................................................................. | 26 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................AATAAAAATAAAAAATAAAGTCTG............................................................................................................................................................................................ | 24 | 1.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..CTCCAGCCTGGGTGCCAGAGCAACGC.............................................................................................................................................................................................................................. | 26 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....CCAGCCTGGGTGCCAGAGCAAGGC.............................................................................................................................................................................................................................. | 24 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................AAAAAATAAAGTGGGTATA........................................................................................................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................AAAAAATAAAGTGGGTTTG........................................................................................................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................CCCACTTTATTTTTTATTTTTATTTTT............................................................................................................................................................................................ | 27 | 2 | 0.50 | 0.50 | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ...........................................................TGGGAAACTGGAGCCC............................................................................................................................................................................... | 16 | 8 | 0.12 | 0.12 | - | - | - | - | - | - | - | - | - | - | 0.12 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |