| (2)  AGO2.ip  | (1)  B-CELL  | (10)  BREAST  | (10)  CELL-LINE  | (6)  CERVIX  | (7)  HEART  | (1)  LIVER  | (1)  OTHER  | (45)  SKIN  | (1)  TESTES  | (1)  XRN.ip  | 
| GCGGGCCTAGAGGGGCGTGGCTTGTGGTTGTGGCCTAGGCGATAGGCGTGGCGCGGGGCTATTGACTAGTGAAGACCAAATTAACACGGGAGGGATGAGCGAGCATTGTGGGGCGGGAGCGGCAGCCAGGTGAGGGGGTCTAACACGTGAGGCCGGGGTGGGCGCGGGCCGCCCCTCACGGCCCCGTCCTGTTCCGGCAGGGTGACTCCGGGGGCCCGCTGGTGTGCGGGGGCGTGCTCGAGGGCGTGGT ....................................................................................(((.((.....((.((..((........))....))..)).))..)))....(((((........)))))................................................................................................ .............................................................................78............................................................................156............................................................................................  | Size | Perfect hit | Total Norm | Perfect Norm | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin)  | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin)  | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin)  | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart)  | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin)  | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin)  | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin)  | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line)  | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin)  | TAX577743(Rovira) total RNA. (breast)  | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin)  | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin)  | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin)  | TAX577744(Rovira) total RNA. (breast)  | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin)  | TAX577745(Rovira) total RNA. (breast)  | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin)  | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin)  | SRR040010(GSM532895) G529N. (cervix)  | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin)  | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin)  | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin)  | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin)  | TAX577589(Rovira) total RNA. (breast)  | TAX577738(Rovira) total RNA. (breast)  | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin)  | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin)  | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart)  | SRR553574(SRX182780) source: Heart. (Heart)  | RoviraIPAgo2(Rovira) total RNA. (ago2 breast)  | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin)  | SRR189784 | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin)  | DRR000561(DRX000319) Isolation of RNA following immunoprecipitatio. (ago2 cell line)  | GSM532876(GSM532876) G547T. (cervix)  | TAX577588(Rovira) total RNA. (breast)  | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin)  | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex)  | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR040037(GSM532922) G243T. (cervix)  | SRR330882(SRX091720) tissue: skin psoriatic uninvolveddisease stat. (skin)  | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line)  | GSM532880(GSM532880) G659T. (cervix)  | SRR191612(GSM715722) 65genomic small RNA (size selected RNA from t. (breast)  | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart)  | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR040009(GSM532894) G727T. (cervix)  | GSM532874(GSM532874) G699T. (cervix)  | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line)  | GSM416733(GSM416733) HEK293. (cell line)  | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line)  | SRR037931(GSM510469) 293GFP. (cell line)  | TAX577741(Rovira) total RNA. (breast)  | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)  | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin)  | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)  | TAX577590(Rovira) total RNA. (breast)  | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin)  | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin)  | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart)  | SRR553576(SRX182782) source: Testis. (testes)  | SRR033728(GSM497073) MALT (MALT413). (B cell)  | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart)  | SRR207116(GSM721078) Nuclear RNA. (cell line)  | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart)  | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin)  | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver)  | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin)  | 
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ......................................................................................................................................GGGGTCTAACACGTGC.................................................................................................... | 16 | 1 | 68.00 | 3.00 | 9.00 | 3.00 | 4.00 | 5.00 | 2.00 | 1.00 | 4.00 | 3.00 | 3.00 | 2.00 | 5.00 | 2.00 | 2.00 | - | - | 1.00 | - | 1.00 | - | - | 2.00 | 2.00 | 2.00 | 1.00 | - | 2.00 | - | - | - | 1.00 | - | 2.00 | - | 1.00 | - | - | - | - | - | 1.00 | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | 
| ......................................................................................................................................GGGGTCTAACACGTGCGC.................................................................................................. | 18 | 1 | 57.00 | 3.00 | 5.00 | 8.00 | 3.00 | 2.00 | 1.00 | 3.00 | 1.00 | 2.00 | - | 1.00 | - | 3.00 | - | - | 1.00 | 2.00 | - | 3.00 | 1.00 | 1.00 | - | 1.00 | - | 2.00 | 1.00 | 1.00 | 1.00 | 1.00 | 2.00 | - | 2.00 | - | 2.00 | - | - | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 
| ......................................................................................................................................GGGGTCTAACACGTGCG................................................................................................... | 17 | 1 | 30.00 | 3.00 | 1.00 | - | 4.00 | 1.00 | 1.00 | 3.00 | - | 1.00 | 1.00 | 1.00 | - | - | 2.00 | - | 3.00 | - | - | - | 2.00 | 1.00 | - | - | - | - | 2.00 | - | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 
| ......................................................................................................................................GGGGTCTAACACGTGCGCG................................................................................................. | 19 | 1 | 7.00 | 3.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | 
| ..................................................................................AACACGGGAGGGATGAG....................................................................................................................................................... | 17 | 1 | 4.00 | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..................................................................................................................................................................................................................................CGGGGGCGTGCTCGA......... | 15 | 1 | 4.00 | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ......................................................................................................................................GGGGTCTAACACGTG..................................................................................................... | 15 | 1 | 3.00 | 3.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..................................................................................................................................................................................CGGCCCCGTCCTGTTCCGGCAGA................................................. | 23 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................................................................GGGGGCGTGCTCGAGGGC..... | 18 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ......................................................................................................................................GGGGTCTAACACGTGAGCAAG............................................................................................... | 21 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................AAATTAACACGGGAGGGATGAGCG..................................................................................................................................................... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .....................................................................................................................................GGGGGTCTAACACGTGCGG.................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................................................................................................GTGACTCCGGGGGCCCGCT.............................. | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 
| .................................................................................................................................................................................................................GGGGGCCCGCTGGTGTG........................ | 17 | 1 | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..................................................................................................................................................................................CGGCCCCGTCCTGTTCCGGCAGT................................................. | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................GGGTCTAACACGTGAGGGAG............................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................................................................CGGGGGCGTGCTCGAGGGCG.... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .....................................................................................ACGGGAGGGATGAGCGAGCA................................................................................................................................................. | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ...........GGGGCGTGGCTTGTGGCG............................................................................................................................................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................GGGGTCTAACACGTGCTCG................................................................................................. | 19 | 1 | 1.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..........AGGGGCGTGGCTTGTCCA.............................................................................................................................................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | |
| .....................................................................................................................................GGGGGTCTAACACGTGCGC.................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................ACGGGAGGGATGAGCGAGC.................................................................................................................................................. | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .............................................................................................................................................................................................................................GTGTGCGGGGGCGTGCTCGA......... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ............................................................................................................TGGGGCGGGAGCGGCT.............................................................................................................................. | 16 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................GGCCCCGTCCTGTTCCGGCAGT................................................. | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................................................................................................CGCTGGTGTGCGGGGGCGTGCTCGAGGGCGT... | 31 | 1 | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ........................................................................................................................................................................................................GGTGACTCCGGGGGCCCGCT.............................. | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ....................................................................................................................................AGGGGGTCTAACACGTGCGCG................................................................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................CGATAGGCGTGGCGCGGGGCTACTG.......................................................................................................................................................................................... | 25 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................CGGGAGGGATGAGCGAGCATTG.............................................................................................................................................. | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 
| ................................................................................................................................................................................................................................TGCGGGGGCGTGCTCGAGGG...... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ......................................................................................................................................GGGGTCTAACACGTGCCAG................................................................................................. | 19 | 1 | 1.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..............................................................................................................................................................................................................................TGTGCGGGGGCGTGCTCGAGGGCG.... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .....................................................................................ACGGGAGGGATGAGCGAG................................................................................................................................................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 
| .....................................................................................................................................GGGGGTCTAACACGTGCG................................................................................................... | 18 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................AGGGATGAGCGAGCATTG.............................................................................................................................................. | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .......................................................................................................................................................................................................................CCGCTGGTGTGCGGGGGCG................ | 19 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ..................................................................................................................................................................................................................GGGGCCCGCTGGTGTGCGGGGGCGT............... | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 
| ...................................................................................................................................................................................GGCCCCGTCCTGTTCCGGCAGA................................................. | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................................................CCCGCTGGTGTGCGGGGGCGTGCTCGAGG....... | 29 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ....................................................................................................................................................GAGGCCGGGGTGGGCGGCT................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................................................................................................GTGACTCCGGGGGCCCGC............................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| GCGGGCCTAGAGGGGCGTGGCTTGTGGTTGTGGCCTAGGCGATAGGCGTGGCGCGGGGCTATTGACTAGTGAAGACCAAATTAACACGGGAGGGATGAGCGAGCATTGTGGGGCGGGAGCGGCAGCCAGGTGAGGGGGTCTAACACGTGAGGCCGGGGTGGGCGCGGGCCGCCCCTCACGGCCCCGTCCTGTTCCGGCAGGGTGACTCCGGGGGCCCGCTGGTGTGCGGGGGCGTGCTCGAGGGCGTGGT ....................................................................................(((.((.....((.((..((........))....))..)).))..)))....(((((........)))))................................................................................................ .............................................................................78............................................................................156............................................................................................  | Size | Perfect hit | Total Norm | Perfect Norm | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin)  | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin)  | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin)  | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart)  | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin)  | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin)  | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin)  | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line)  | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin)  | TAX577743(Rovira) total RNA. (breast)  | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin)  | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin)  | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin)  | TAX577744(Rovira) total RNA. (breast)  | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin)  | TAX577745(Rovira) total RNA. (breast)  | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin)  | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin)  | SRR040010(GSM532895) G529N. (cervix)  | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin)  | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin)  | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin)  | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin)  | TAX577589(Rovira) total RNA. (breast)  | TAX577738(Rovira) total RNA. (breast)  | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin)  | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin)  | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart)  | SRR553574(SRX182780) source: Heart. (Heart)  | RoviraIPAgo2(Rovira) total RNA. (ago2 breast)  | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin)  | SRR189784 | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin)  | DRR000561(DRX000319) Isolation of RNA following immunoprecipitatio. (ago2 cell line)  | GSM532876(GSM532876) G547T. (cervix)  | TAX577588(Rovira) total RNA. (breast)  | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin)  | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex)  | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR040037(GSM532922) G243T. (cervix)  | SRR330882(SRX091720) tissue: skin psoriatic uninvolveddisease stat. (skin)  | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line)  | GSM532880(GSM532880) G659T. (cervix)  | SRR191612(GSM715722) 65genomic small RNA (size selected RNA from t. (breast)  | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart)  | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR040009(GSM532894) G727T. (cervix)  | GSM532874(GSM532874) G699T. (cervix)  | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line)  | GSM416733(GSM416733) HEK293. (cell line)  | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line)  | SRR037931(GSM510469) 293GFP. (cell line)  | TAX577741(Rovira) total RNA. (breast)  | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)  | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin)  | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)  | TAX577590(Rovira) total RNA. (breast)  | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin)  | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin)  | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart)  | SRR553576(SRX182782) source: Testis. (testes)  | SRR033728(GSM497073) MALT (MALT413). (B cell)  | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart)  | SRR207116(GSM721078) Nuclear RNA. (cell line)  | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart)  | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin)  | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver)  | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin)  | 
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .............................................................................................................................................................GTGGGCGCGGGCCGCCCGCAG........................................................................ | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................................................................................CCGGGGGCCCGCTGGTGGG........................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................CCAAATTAACACGGGAGTAT........................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................................GGGCGCGGGCCGCCCCGC......................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................CGGAACAGGACGGGGCC...................................................... | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ...............................................................................................................................................................................................................CCGGGGGCCCGCTGGTTGG........................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................................................................................CCGGGGGCCCGCTGGT........................... | 16 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................................................................................CCGGGGGCCCGCTGGTGG......................... | 18 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................................................................................CCGGGGGCCCGCTGGTTG......................... | 18 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................CGTGTTAATTTGGTCTTC.................................................................................................................................................................. | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ......................................................................................................TGCCGCTCCCGCCCCACAATGC.............................................................................................................................. | 22 | 1 | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |