| (1) B-CELL | (1) BRAIN | (4) BREAST | (14) CELL-LINE | (2) CERVIX | (2) HEART | (3) HELA | (2) LIVER | (4) OTHER | (11) SKIN | (1) XRN.ip |
| TTATTTATTTATTTATTTTTACCAGTGTGCAGTATGCCTATGTAATACTATAAGCGTTTTAGTTTTTAAAATTGTAATGCTTTCTGTTGCTCATATATTGATCAAAAACTGATCAACCTATGAGTAGTACTTTGAGGTTGTATGTGTTCGATTTTGTCTCCTCCTGCAGTGAATTGATTTTTCTTGAGCAGATTGATTAGATGGAGCTGCCTTGATTTACACATCAGTGAAAGAAGAGAAAAACCTCGAC .........................................................................................................................(((.((.((...(((((((........))))))))))).)))((((...(((.......)))....))))........................................................... ....................................................................................................................117................................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | DRR001486(DRX001040) "Hela long cytoplasmic cell fraction, LNA(+)". (hela) | SRR037943(GSM510481) 293DcrTN. (cell line) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR040018(GSM532903) G701N. (cervix) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR189778(GSM714638) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189777(GSM714637) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR343334 | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | SRR189787 | SRR040028(GSM532913) G026N. (cervix) | SRR444046(SRX128894) Sample 7cDNABarcode: AF-PP-342: ACG CTC TTC C. (skin) | SRR343336 | DRR001484(DRX001038) "Hela long nuclear cell fraction, control". (hela) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR033724(GSM497069) L428 cell line (L428). (B cell) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR189782 | SRR037937(GSM510475) 293cand2. (cell line) | TAX577739(Rovira) total RNA. (breast) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577590(Rovira) total RNA. (breast) | GSM359178(GSM359178) hela_nucl_t. (hela) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR038863(GSM458546) MM603. (cell line) | SRR189776(GSM714636) cell line: HEK293clip variant: CLIPenzymatic . (cell line) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR039624(GSM531987) HBV(-) HCV(-) Adjacent Tissue Sample. (liver) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR191622(GSM715732) 175genomic small RNA (size selected RNA from . (breast) | SRR189775(GSM714635) cell line: HEK293clip variant: CLIPenzymatic . (cell line) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577740(Rovira) total RNA. (breast) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...................................................................................................................................................................................TTTCTTGAGCAGATTGATTAGA................................................. | 22 | 1 | 25.00 | 25.00 | 22.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................ATGTGTTCGATTTTGTCTCCTCCTGCAGTGAATTGATTTTTCTTGAGCAGATTGATTA................................................... | 58 | 1 | 6.00 | 6.00 | - | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................TTTCTTGAGCAGATTGATTAGATTTA............................................. | 26 | 5.00 | 0.00 | - | - | 5.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................................................GATTTTTCTTGAGCAGATTGATTAGA................................................. | 26 | 1 | 3.00 | 3.00 | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................TTTCTTGAGCAGATTGATTAGAA................................................ | 23 | 1 | 3.00 | 25.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................................................................................ACATCAGTGAAAGAAGAGAAA......... | 21 | 1 | 2.00 | 2.00 | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................ATTAGATGGAGCTGCCTTGATTTACACACCAG....................... | 32 | 2.00 | 0.00 | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................................................................................AGTGAAAGAAGAGAAAAACC..... | 20 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................GAGTAGTACTTTGAGGTTGTATGTG........................................................................................................ | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..ATTTATTTATTTATTTTTACCAG................................................................................................................................................................................................................................. | 23 | 2 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - |
| ...........................................AATACTATAAGCGTTTTAGTTTTTAAAATTGTAATGCTTTCTGTTGCTCATATATTGATCAAAAACTGATCAACCTATGAGTAGTACTTTG.................................................................................................................... | 91 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .TATTTATTTATTTATTTTTACCACCAG.............................................................................................................................................................................................................................. | 27 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................TTTTCTTGAGCAGATTGATTAG.................................................. | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................................AGCAGATTGATTAGATGGAGCTGC........................................ | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................................................................AGAAGAGAAAAACCTCGA. | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - |
| ........................................................................................................................TGAGTAGTACTTTGAGGTT............................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................................ATGGAGCTGCCTTGATTTA............................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................TATGTGTTCGATTTTGTCTCCT........................................................................................ | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................................................................GATTTACACATCAGTGAAAGAAGAGA........... | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................GTGAATTGATTTTTCTTGAGCAGATTGATTAG.................................................. | 32 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................................................CAGATTGATTAGATGGAGCTGCCTTGATTT................................ | 30 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................................................................................CATCAGTGAAAGAAGAGAAAAACCTC... | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................TGAGCAGATTGATTAGTT................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................................................................AGAAGAGAAAAACCTCGAC | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - |
| ..ATTTATTTATTTATTTTTACCATCAT.............................................................................................................................................................................................................................. | 26 | 1.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..ATTTATTTATTTATTTTTACCACCAG.............................................................................................................................................................................................................................. | 26 | 1.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................ATGCTTTCTGTTGCTTATG........................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | |
| .........................................................................................................................GAGTAGTACTTTGAGGTTGTATGTGTTC..................................................................................................... | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................TTGAGCAGATTGATTAGATGGAGCT.......................................... | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - |
| ............................................................................................................CTGATCAACCTATGAGTAGTAC........................................................................................................................ | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................TTTCTTGAGCAGATTGATTAGAAAA.............................................. | 25 | 1 | 1.00 | 25.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................................................AGATGGAGCTGCCTTGATTTACACATCA........................ | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................TTTCTTGAGCAGATTGATTAG.................................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - |
| ..................................................................................................................................................................................TTTTCTTGAGCAGATTGATTAGAA................................................ | 24 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................TTTCTTGAGCAGATTGATTAGT................................................. | 22 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................................................CAGATTGATTAGATGGAGCT.......................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................................................................GCTGCCTTGATTTACACATCAGTG..................... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................CTATGAGTAGTACTTTG.................................................................................................................... | 17 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .TATTTATTTATTTATTTTTACCAG................................................................................................................................................................................................................................. | 24 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - |
| .......................................................................................................................ATGAGTAGTACTTTG.................................................................................................................... | 15 | 8 | 0.12 | 0.12 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.12 | - |
| .....................................................................................................................................................................................................................................AAAGAAGAGAAAAACCT.... | 17 | 9 | 0.11 | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 |
| TTATTTATTTATTTATTTTTACCAGTGTGCAGTATGCCTATGTAATACTATAAGCGTTTTAGTTTTTAAAATTGTAATGCTTTCTGTTGCTCATATATTGATCAAAAACTGATCAACCTATGAGTAGTACTTTGAGGTTGTATGTGTTCGATTTTGTCTCCTCCTGCAGTGAATTGATTTTTCTTGAGCAGATTGATTAGATGGAGCTGCCTTGATTTACACATCAGTGAAAGAAGAGAAAAACCTCGAC .........................................................................................................................(((.((.((...(((((((........))))))))))).)))((((...(((.......)))....))))........................................................... ....................................................................................................................117................................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | DRR001486(DRX001040) "Hela long cytoplasmic cell fraction, LNA(+)". (hela) | SRR037943(GSM510481) 293DcrTN. (cell line) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR040018(GSM532903) G701N. (cervix) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR189778(GSM714638) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189777(GSM714637) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR343334 | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | SRR189787 | SRR040028(GSM532913) G026N. (cervix) | SRR444046(SRX128894) Sample 7cDNABarcode: AF-PP-342: ACG CTC TTC C. (skin) | SRR343336 | DRR001484(DRX001038) "Hela long nuclear cell fraction, control". (hela) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR033724(GSM497069) L428 cell line (L428). (B cell) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR189782 | SRR037937(GSM510475) 293cand2. (cell line) | TAX577739(Rovira) total RNA. (breast) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577590(Rovira) total RNA. (breast) | GSM359178(GSM359178) hela_nucl_t. (hela) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR038863(GSM458546) MM603. (cell line) | SRR189776(GSM714636) cell line: HEK293clip variant: CLIPenzymatic . (cell line) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR039624(GSM531987) HBV(-) HCV(-) Adjacent Tissue Sample. (liver) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR191622(GSM715732) 175genomic small RNA (size selected RNA from . (breast) | SRR189775(GSM714635) cell line: HEK293clip variant: CLIPenzymatic . (cell line) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577740(Rovira) total RNA. (breast) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..................................................................................................................................................................................................GATTAGATGGAGCTGG........................................ | 16 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................................TTGTATGTGTTCGATTAC............................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................ACTATAAGCGTTTTATCAT......................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................TGTTGCTCATATATTGCG.................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................TGTGTTCGATTTTGTAG........................................................................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |