| (1)  AGO1.ip  | (2)  B-CELL  | (2)  BRAIN  | (3)  BREAST  | (20)  CELL-LINE  | (2)  CERVIX  | (1)  FIBROBLAST  | (1)  HEART  | (7)  LIVER  | (1)  OTHER  | (1)  RRP40.ip  | (3)  SKIN  | (1)  TESTES  | (3)  UTERUS  | (1)  XRN.ip  | 
| AGGGCTGCCTAAGGTGTGTGTTGGCCAACTCATGGCAGCGACTGCAATAGGTGACGTGTTAAAGGGAGAGGGTCTGCAGCTGGAGACTCCAGGCGGGTGATGCAGTCCGGATAGGAGGAGATGGGGAATGGAACCAGGTTCACAGGGACTTTCAGGGGTGGAAAAGGCATTTTCCGGCACTCCCCTCCCCCTGCTCCCAGGTTGTCATGAAGGTTGACGTGGTGTATGAGAAGCAGATGCTCTACCTCTA .........................................................................................................((((....(((((...(((((..((....))..))).))....))))).....))))........................................................................................ .......................................................................................................104...........................................................166..................................................................................  | Size | Perfect hit | Total Norm | Perfect Norm | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver)  | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line)  | SRR207113(GSM721075) IP against AGO 1 & 2. (ago1/2 cell line)  | SRR038855(GSM458538) D10. (cell line)  | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus)  | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus)  | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver)  | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line)  | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line)  | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver)  | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver)  | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line)  | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line)  | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus)  | SRR039613(GSM531976) Human Normal Liver Tissue Sample 3. (liver)  | SRR207116(GSM721078) Nuclear RNA. (cell line)  | TAX577745(Rovira) total RNA. (breast)  | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver)  | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell)  | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver)  | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart)  | SRR207111(GSM721073) Whole cell RNA. (cell line)  | GSM450609(GSM450609) miRNA sequencing raw reads from post-mortem s. (brain)  | GSM532874(GSM532874) G699T. (cervix)  | SRR060984(GSM569188) Human plasma cell [09-001]. (cell line)  | SRR037876(GSM522374) fibroblasts_cell_culture. (fibroblast)  | SRR189785 | SRR040031(GSM532916) G013T. (cervix)  | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell)  | SRR038854(GSM458537) MM653. (cell line)  | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)  | TAX577742(Rovira) total RNA. (breast)  | SRR029126(GSM416755) 143B. (cell line)  | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line)  | SRR553576(SRX182782) source: Testis. (testes)  | GSM450600(GSM450600) miRNA sequencing raw reads from post-mortem s. (brain)  | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line)  | TAX577589(Rovira) total RNA. (breast)  | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line)  | SRR038863(GSM458546) MM603. (cell line)  | SRR060986(GSM569190) Human memory B cell [09-001]. (cell line)  | SRR029131(GSM416760) MCF7. (cell line)  | SRR038862(GSM458545) MM472. (cell line)  | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin)  | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin)  | 
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...............................................................................................................................................AGGGACTTTCAGGGGCAGA........................................................................................ | 19 | 17.00 | 0.00 | - | 2.00 | 5.00 | - | - | 1.00 | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | 1.00 | 1.00 | - | - | 1.00 | 1.00 | - | |
| ...............................................................................................................................................AGGGACTTTCAGGGGCAGT........................................................................................ | 19 | 12.00 | 0.00 | - | 1.00 | - | 4.00 | 3.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | |
| ...............................................................................................................................................AGGGACTTTCAGGGGCAAA........................................................................................ | 19 | 8.00 | 0.00 | 1.00 | 1.00 | - | - | 1.00 | - | - | 2.00 | 1.00 | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................AGGGACTTTCAGGGGCAA......................................................................................... | 18 | 7.00 | 0.00 | - | 2.00 | - | - | - | - | - | - | 2.00 | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................AGGGACTTTCAGGGGTAGCT....................................................................................... | 20 | 4.00 | 0.00 | - | - | - | - | - | 2.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................................................AGGTTGACGTGGTGTATGAGAAG................. | 23 | 1 | 3.00 | 3.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ...............................................................................................................................................AGGGACTTTCAGGGGCAAT........................................................................................ | 19 | 3.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................AGGGACTTTCAGGGGCCGC........................................................................................ | 19 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................AGGGACTTTCAGGGGCATC........................................................................................ | 19 | 2.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................AGGGACTTTCAGGGGCAGG........................................................................................ | 19 | 2.00 | 0.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................AGGGACTTTCAGGGGTAGC........................................................................................ | 19 | 2.00 | 0.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................AGGGACTTTCAGGGGCAT......................................................................................... | 18 | 2.00 | 0.00 | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................AGGGACTTTCAGGGGGAGT........................................................................................ | 19 | 2.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................................................ATGAAGGTTGACGTGGTGT......................... | 19 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ...............................................................................................................................................AGGGACTTTCAGGGGGAGC........................................................................................ | 19 | 2.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................AGGGACTTTCAGGGGCAAG........................................................................................ | 19 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................GGATAGGAGGAGATGGGGAATGGAA..................................................................................................................... | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ...................................................................................................................AGGAGATGGGGAATGGAACCA.................................................................................................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ...............................................................................................................................................................................................................TGAAGGTTGACGTGGTGTA........................ | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .......................................................................................................................................................................................................................GACGTGGTGTATGAGAAGCAGATG........... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ...............................................................................................................................................AGGGACTTTCAGGGGAAGA........................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................GCGACTGCAATAGGTGACGTG................................................................................................................................................................................................ | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| .............................................................................................................................................................................................................CATGAAGGTTGACGTGGTGTATGA..................... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 
| .................................................................................................................................................................................CACTCCCCTCCCCCTGATC...................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | |
| ...............................................................GGGAGAGGGTCTGCAGAT......................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | |
| .......................................................................................................................................................................................................GGTTGTCATGAAGGTTGACGTGGT........................... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ...............................................................................................................................................AGGGACTTTCAGGGGTACC........................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................ACTTTCAGGGGTGGAGGA..................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................................................ATGAAGGTTGACGTGGTGTATGAGAAGCA............... | 29 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 
| ...............................................................................................................................................AGGGACTTTCAGGGGTGGCTGT..................................................................................... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................................CAGGGGTGGAAAAGGC.................................................................................. | 16 | 5 | 0.20 | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | 
| AGGGCTGCCTAAGGTGTGTGTTGGCCAACTCATGGCAGCGACTGCAATAGGTGACGTGTTAAAGGGAGAGGGTCTGCAGCTGGAGACTCCAGGCGGGTGATGCAGTCCGGATAGGAGGAGATGGGGAATGGAACCAGGTTCACAGGGACTTTCAGGGGTGGAAAAGGCATTTTCCGGCACTCCCCTCCCCCTGCTCCCAGGTTGTCATGAAGGTTGACGTGGTGTATGAGAAGCAGATGCTCTACCTCTA .........................................................................................................((((....(((((...(((((..((....))..))).))....))))).....))))........................................................................................ .......................................................................................................104...........................................................166..................................................................................  | Size | Perfect hit | Total Norm | Perfect Norm | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver)  | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line)  | SRR207113(GSM721075) IP against AGO 1 & 2. (ago1/2 cell line)  | SRR038855(GSM458538) D10. (cell line)  | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus)  | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus)  | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver)  | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line)  | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line)  | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver)  | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver)  | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line)  | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line)  | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus)  | SRR039613(GSM531976) Human Normal Liver Tissue Sample 3. (liver)  | SRR207116(GSM721078) Nuclear RNA. (cell line)  | TAX577745(Rovira) total RNA. (breast)  | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver)  | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin)  | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell)  | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver)  | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart)  | SRR207111(GSM721073) Whole cell RNA. (cell line)  | GSM450609(GSM450609) miRNA sequencing raw reads from post-mortem s. (brain)  | GSM532874(GSM532874) G699T. (cervix)  | SRR060984(GSM569188) Human plasma cell [09-001]. (cell line)  | SRR037876(GSM522374) fibroblasts_cell_culture. (fibroblast)  | SRR189785 | SRR040031(GSM532916) G013T. (cervix)  | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell)  | SRR038854(GSM458537) MM653. (cell line)  | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line)  | TAX577742(Rovira) total RNA. (breast)  | SRR029126(GSM416755) 143B. (cell line)  | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line)  | SRR553576(SRX182782) source: Testis. (testes)  | GSM450600(GSM450600) miRNA sequencing raw reads from post-mortem s. (brain)  | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line)  | TAX577589(Rovira) total RNA. (breast)  | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line)  | SRR038863(GSM458546) MM603. (cell line)  | SRR060986(GSM569190) Human memory B cell [09-001]. (cell line)  | SRR029131(GSM416760) MCF7. (cell line)  | SRR038862(GSM458545) MM472. (cell line)  | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin)  | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin)  | 
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ............................................................AAAGGGAGAGGGTCTGTAA........................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................GGTGACGTGTTAAAGAGA....................................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................................................................AAGCAGATGCTCTACCGG.. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................GCACTCCCCTCCCCCTAATT...................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................GCACTCCCCTCCCCCTAAA....................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |