| (1) AGO2.ip | (1) BRAIN | (6) BREAST | (7) CELL-LINE | (1) CERVIX | (2) HEART | (4) HELA | (1) LIVER | (3) OTHER | (18) SKIN | (1) UTERUS |
| CTTTTCCTGCATCTGTGACAGTGGCTTTACTGGCACCTACTGCCATGAGAGTGAGTGGCCACGAACGGCGGGCTGGTGGTGGGGCTGGGCTGGCCTGAGGCCCTGGCTCACCCCGCTCGCCTCTGCAGACATTGACGACTGCCTGGGCCAGCCCTGCCGCAATGGGGGCACATGCATC ...................................................................(((((..((((((((((.((((((((((...))))..)))))))))))).))))))))).................................................... ..............................................................63...............................................................128................................................ | Size | Perfect hit | Total Norm | Perfect Norm | DRR001485(DRX001039) "Hela long total cell fraction, LNA(+)". (hela) | DRR001486(DRX001040) "Hela long cytoplasmic cell fraction, LNA(+)". (hela) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR029124(GSM416753) HeLa. (hela) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR189782 | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | TAX577743(Rovira) total RNA. (breast) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040034(GSM532919) G001N. (cervix) | SRR191427(GSM715537) 153genomic small RNA (size selected RNA from . (breast) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR191604(GSM715714) 74genomic small RNA (size selected RNA from t. (breast) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR189785 | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR095854(SRX039177) "miRNA were isolated from FirstChoice Human B. (brain) | TAX577739(Rovira) total RNA. (breast) | SRR191549(GSM715659) 105genomic small RNA (size selected RNA from . (breast) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | GSM1105749AGO2(GSM1105749) small RNA sequencing data. (ago2 hela) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | TAX577738(Rovira) total RNA. (breast) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR039637(GSM518474) THP1_total_sRNAs. (cell line) | SRR029125(GSM416754) U2OS. (cell line) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..................................................GTGAGTGGCCACGAACGGCGGGCTGGTGGTGGGGCTGGGCTGGCCTGAGGCCCTGGCTCACCCCGCTCGCCTCTGCAG.................................................. | 78 | 1 | 16.00 | 16.00 | 16.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................TGAGTGGCCACGAACGGCGGGCTGGTGGTGGGGCTGGGCTGGCCTGAGGCCCTGGCTCACCCCTTT............................................................. | 66 | 6.00 | 0.00 | - | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................TGGCTCACCCCGCTCGCCTCT...................................................... | 21 | 1 | 6.00 | 6.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - |
| ..................................................GTGAGTGGCCACGAACGGCGGGCTGGTGGTGGGGCTGGGCTGGCCTGAGGCCCTGGCTCACC.................................................................. | 62 | 1 | 5.00 | 5.00 | 5.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................GTGAGTGGCCACGAACGGCGGGCTGGTGGTGGGGCTGGGCTGGCCTGAGGCCCTGGCTC..................................................................... | 59 | 1 | 3.00 | 3.00 | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................TGGCTCACCCCGCTCGCCTCTAAT................................................... | 24 | 1 | 3.00 | 6.00 | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................GTGAGTGGCCACGAACGGCGGGCTGGTGGTGGGGCTGGGCTGGCCTGAGGCCCTGGCTCACCC................................................................. | 63 | 1 | 2.00 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................TGGGCTGGCCTGAGGCCCTGGCTCACC.................................................................. | 27 | 1 | 2.00 | 2.00 | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........TCTGTGACAGTGGCTTTAC.................................................................................................................................................... | 19 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - |
| ..................................................GTGAGTGGCCACGAACGGCGGGCTGGTGGTGGGGCTGGGCTGGCCTGAGGCCCTGGCTCACCT................................................................. | 63 | 1 | 2.00 | 5.00 | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................TGGCCTGAGGCCCTGGC....................................................................... | 17 | 3 | 1.67 | 1.67 | - | - | - | 0.33 | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.67 | 0.33 | - |
| ...................................................................GCGGGCTGGTGGTGGGGCTGGG......................................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................GGGCTGGCCTGAGGCCCAGT........................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | |
| .......................................................................................................TGGCTCACCCCGCTCGCCTCTGT.................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - |
| ......................................................................................................................................ACGACTGCCTGGGCCAAGC......................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................CACCTACTGCCATGAGAGTGA............................................................................................................................ | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................AGTGGCCACGAACGGCGGGCTGG...................................................................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................TGGCTCACCCCGCTCGCCT........................................................ | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - |
| .......................................................................................................TGGCTCACCCCGCTCGCCTCTG..................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................CACGAACGGCGGGCTGGTGGGG................................................................................................. | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................GAACGGCGGGCTGGTTCCA................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................CGAACGGCGGGCTGGTGGTG................................................................................................. | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - |
| ...................................................TGAGTGGCCACGAACGGCGGGCTGGTGGTGGGGC............................................................................................. | 34 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................TGGCTCACCCCGCTCGCCTCTGA.................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................TGGTGGGGCTGGGCTGGC.................................................................................... | 18 | 2 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................GCTGGTGGTGGGGCTGGGCTGGCCTGAGG.............................................................................. | 29 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................TGGCTCACCCCGCTCGCCTCTT..................................................... | 22 | 1 | 1.00 | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................GAGTGGCCACGAACGGCGGGC......................................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................ACGGCGGGCTGGTGGTGATTT............................................................................................. | 21 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................ACGGCGGGCTGGTGGTGGGGCTGG.......................................................................................... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................CGGGCTGGTGGTGGGGCTGGG......................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................TGGCTCACCCCGCTCGCCTA....................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................ACGGCGGGCTGGTGGTGGGGCTGGTT........................................................................................ | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................GACGACTGCCTGGGCCAGCCCTGCCGC.................. | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................GCGGGCTGGTGGTGGGGCTGGGCAA...................................................................................... | 25 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................ACGGCGGGCTGGTGGGGG................................................................................................ | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................AGTGGCCACGAACGGCGGGCTGGTGGTGGGGG............................................................................................. | 32 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | |
| ................................................................ACGGCGGGCTGGTGGTGGAG.............................................................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................AACGGCGGGCTGGTGGTG................................................................................................. | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................CATTGACGACTGCCTGG................................ | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................CGGGCTGGTGGTGGGGCTGGGCTG...................................................................................... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................ACAGTGGCTTTACTGGTGCC............................................................................................................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................CTGGCTCACCCCGCTCGCCTCT...................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................AGTGGCCACGAACGGCGGGC......................................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................ACGGCGGGCTGGTGG................................................................................................... | 15 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................AACGGCGGGCTGGTGGTGGGGCTG........................................................................................... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................TGGCCACGAACGGCGGGCTGGTGG................................................................................................... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................TGGGCTGGCCTGAGGC............................................................................. | 16 | 9 | 0.11 | 0.11 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.11 |
| CTTTTCCTGCATCTGTGACAGTGGCTTTACTGGCACCTACTGCCATGAGAGTGAGTGGCCACGAACGGCGGGCTGGTGGTGGGGCTGGGCTGGCCTGAGGCCCTGGCTCACCCCGCTCGCCTCTGCAGACATTGACGACTGCCTGGGCCAGCCCTGCCGCAATGGGGGCACATGCATC ...................................................................(((((..((((((((((.((((((((((...))))..)))))))))))).))))))))).................................................... ..............................................................63...............................................................128................................................ | Size | Perfect hit | Total Norm | Perfect Norm | DRR001485(DRX001039) "Hela long total cell fraction, LNA(+)". (hela) | DRR001486(DRX001040) "Hela long cytoplasmic cell fraction, LNA(+)". (hela) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR029124(GSM416753) HeLa. (hela) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR189782 | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | TAX577743(Rovira) total RNA. (breast) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040034(GSM532919) G001N. (cervix) | SRR191427(GSM715537) 153genomic small RNA (size selected RNA from . (breast) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR191604(GSM715714) 74genomic small RNA (size selected RNA from t. (breast) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR189785 | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR095854(SRX039177) "miRNA were isolated from FirstChoice Human B. (brain) | TAX577739(Rovira) total RNA. (breast) | SRR191549(GSM715659) 105genomic small RNA (size selected RNA from . (breast) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | GSM1105749AGO2(GSM1105749) small RNA sequencing data. (ago2 hela) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | TAX577738(Rovira) total RNA. (breast) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR039637(GSM518474) THP1_total_sRNAs. (cell line) | SRR029125(GSM416754) U2OS. (cell line) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..............................................................CCACCAGCCCGCCGTTC................................................................................................... | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |