| (7) B-CELL | (5) BRAIN | (7) BREAST | (12) CELL-LINE | (3) CERVIX | (2) HEART | (2) HELA | (1) KIDNEY | (5) LIVER | (2) OTHER | (1) RRP40.ip | (23) SKIN | (1) UTERUS |
| GCTGGACGTCATCAACAAGCATTCATTCAACAACTTCCGCCTGCGAGTGGGTGAGAGACTTCCCCTGCTGCAGCAGTCTGGTACCTCCTCACCTTCCTGAGCTTGCCCCACTCCAAGTCCTTTGTTAGCTGCTCCCAGTTCATCCTGAAGCCCCTTTCCTGACTCACTCCCTGGGATGGGGTGTGAAGGTGCTGGGCAAGGAGGTACGAGGCTCTCCCACTCTTTTTCTTAAGCTACATTCCTCCAGCCCTTAGAGACCCCTCCTCTCCTCTAGGGCCCCCCAGGCTCTTCTCCCTTCCTTCCAGTTCCTTGTGGCTTCCTCTTCCCCTCTTCCTTCTCCAAGTCTGTCATTACCACATCCCTCATTAGGGTTGAACCATGGACCCGTAGTAGCTGGAGTTATTGGGGCCCAGAAGCCG ................................................................((((....))))...(((((((.((((......))))...((((((..(((........(((((..(((..(((......))).))).......)))))........)))..))))))....))))))).................................................................................................................................................................................................................................. ...............................................................64................................................................................................................................194............................................................................................................................................................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR033729(GSM497074) splenic MZL (Splenic414). (B cell) | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189784 | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR037937(GSM510475) 293cand2. (cell line) | SRR314796(SRX084354) "Total RNA, fractionated (15-30nt)". (cell line) | TAX577739(Rovira) total RNA. (breast) | TAX577741(Rovira) total RNA. (breast) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line) | TAX577744(Rovira) total RNA. (breast) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | TAX577745(Rovira) total RNA. (breast) | SRR039624(GSM531987) HBV(-) HCV(-) Adjacent Tissue Sample. (liver) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | TAX577580(Rovira) total RNA. (breast) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | GSM450604(GSM450604) miRNA sequencing raw reads from post-mortem s. (brain) | SRR040028(GSM532913) G026N. (cervix) | SRR033716(GSM497061) Mentle Cell Lymphoma (MCL114). (B cell) | SRR189785 | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR039612(GSM531975) Human Normal Liver Tissue Sample 2. (liver) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | DRR001486(DRX001040) "Hela long cytoplasmic cell fraction, LNA(+)". (hela) | SRR039635(GSM518472) THP1_nuc_sRNAs. (cell line) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | GSM532873(GSM532873) G699N. (cervix) | TAX577579(Rovira) total RNA. (breast) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | TAX577738(Rovira) total RNA. (breast) | SRR040020(GSM532905) G699N_2. (cervix) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553574(SRX182780) source: Heart. (Heart) | SRR444040(SRX128888) Sample 1cDNABarcode: AF-PP-333: ACG CTC TTC C. (skin) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR015360(GSM380325) Plasma B cells (PC137). (B cell) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...........................................................................................................................................................................TGGGATGGGGTGTGATAGG..................................................................................................................................................................................................................................... | 19 | 44.00 | 0.00 | 5.00 | 2.00 | - | 2.00 | 3.00 | - | 2.00 | - | 1.00 | 2.00 | 2.00 | - | - | - | 2.00 | - | - | 2.00 | - | - | 1.00 | - | 2.00 | 1.00 | 2.00 | 1.00 | 1.00 | 1.00 | 2.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................TGGGATGGGGTGTGATAA...................................................................................................................................................................................................................................... | 18 | 3.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................TGGGATGGGGTGTGATAAA..................................................................................................................................................................................................................................... | 19 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................TGGGATGGGGTGTGATATC..................................................................................................................................................................................................................................... | 19 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................................................GGGCAAGGAGGTACGAGGC............................................................................................................................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................TGGGATGGGGTGTGAACA...................................................................................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................TGGGATGGGGTGTGAAGGGGG................................................................................................................................................................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................TGGGATGGGGTGTGATCTG..................................................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................TGCAGCAGTCTGGTACGTG............................................................................................................................................................................................................................................................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................TGGGATGGGGTGTGATAGC..................................................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................................GGATGGGGTGTGAAGGTGGC.................................................................................................................................................................................................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................................CTGGGATGGGGTGTGAGCTT..................................................................................................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................TGGGATGGGGTGTGAGAGG..................................................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................TGGGATGGGGTGTGATAGA..................................................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................................................AGGCTCTCCCACTCTAAA................................................................................................................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................................................................................................................................................GCTCTTCTCCCTTCCTGCT.................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................................TGGGCAAGGAGGTACTGTT................................................................................................................................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................................................................GAAGGTGCTGGGCAAGGACG....................................................................................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................................................................GAAGGTGCTGGGCAAGGGCC....................................................................................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................................................................................................................................................................................................................TTGAACCATGGACCC................................. | 15 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| GCTGGACGTCATCAACAAGCATTCATTCAACAACTTCCGCCTGCGAGTGGGTGAGAGACTTCCCCTGCTGCAGCAGTCTGGTACCTCCTCACCTTCCTGAGCTTGCCCCACTCCAAGTCCTTTGTTAGCTGCTCCCAGTTCATCCTGAAGCCCCTTTCCTGACTCACTCCCTGGGATGGGGTGTGAAGGTGCTGGGCAAGGAGGTACGAGGCTCTCCCACTCTTTTTCTTAAGCTACATTCCTCCAGCCCTTAGAGACCCCTCCTCTCCTCTAGGGCCCCCCAGGCTCTTCTCCCTTCCTTCCAGTTCCTTGTGGCTTCCTCTTCCCCTCTTCCTTCTCCAAGTCTGTCATTACCACATCCCTCATTAGGGTTGAACCATGGACCCGTAGTAGCTGGAGTTATTGGGGCCCAGAAGCCG ................................................................((((....))))...(((((((.((((......))))...((((((..(((........(((((..(((..(((......))).))).......)))))........)))..))))))....))))))).................................................................................................................................................................................................................................. ...............................................................64................................................................................................................................194............................................................................................................................................................................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | SRR033729(GSM497074) splenic MZL (Splenic414). (B cell) | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189784 | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR037937(GSM510475) 293cand2. (cell line) | SRR314796(SRX084354) "Total RNA, fractionated (15-30nt)". (cell line) | TAX577739(Rovira) total RNA. (breast) | TAX577741(Rovira) total RNA. (breast) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line) | TAX577744(Rovira) total RNA. (breast) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | TAX577745(Rovira) total RNA. (breast) | SRR039624(GSM531987) HBV(-) HCV(-) Adjacent Tissue Sample. (liver) | SRR444061(SRX128909) Sample 19cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | TAX577580(Rovira) total RNA. (breast) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | GSM450604(GSM450604) miRNA sequencing raw reads from post-mortem s. (brain) | SRR040028(GSM532913) G026N. (cervix) | SRR033716(GSM497061) Mentle Cell Lymphoma (MCL114). (B cell) | SRR189785 | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR039612(GSM531975) Human Normal Liver Tissue Sample 2. (liver) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | DRR001486(DRX001040) "Hela long cytoplasmic cell fraction, LNA(+)". (hela) | SRR039635(GSM518472) THP1_nuc_sRNAs. (cell line) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | GSM532873(GSM532873) G699N. (cervix) | TAX577579(Rovira) total RNA. (breast) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | TAX577738(Rovira) total RNA. (breast) | SRR040020(GSM532905) G699N_2. (cervix) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553574(SRX182780) source: Heart. (Heart) | SRR444040(SRX128888) Sample 1cDNABarcode: AF-PP-333: ACG CTC TTC C. (skin) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR015360(GSM380325) Plasma B cells (PC137). (B cell) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...........................................................................................................................................................................................................................................ACATTCCTCCAGCCCGGCA..................................................................................................................................................................... | 19 | 4.00 | 0.00 | - | 2.00 | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................AACAAAGGACTTGGAGTGG..................................................................................................................................................................................................................................................................................................... | 19 | 1 | 3.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................................................................................ACATTCCTCCAGCCCTTGGC.................................................................................................................................................................... | 20 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................................................................................................................................................................................................................................................................CCAGCTACTACGGGTCCATGG...................... | 21 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................................................................................................................................................................................................................................TGGACCCGTAGTAGCTAA...................... | 18 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................................................................................................................AGAGGAGAGGAGGGGTCTCTAAGGGCTGGAGGA................................................................................................................................................... | 33 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................GTACCAGACTGCTGCAGC............................................................................................................................................................................................................................................................................................................................................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................................................................................................................................................................................TTCCTTCTCCAAGTCTGTAA..................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................................................................................................................................................................................................GCCACAAGGAACTGGAAGG....................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................CAGGATGAACTGGGAGCAGCT................................................................................................................................................................................................................................................................................ | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................................................................................................................................................GCCACAAGGAACTGGAAGGAAG....................................................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................AGGGAGTGAGTCAGGAAAGGGG....................................................................................................................................................................................................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................................................................................................................................................................TTCCCCTCTTCCTTCTTTT.............................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................................................................................CTAAGGGCTGGAGGAATGT..................................................................................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................CTTCAGGATGAACTGGGAG............................................................................................................................................................................................................................................................................. | 19 | 1 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................................................................................................................................................................................TTCCTCTTCCCCTCTTTGG.................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................................................................CTTAAGCTACATTCCCGGG............................................................................................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................................................................................................................GCTACATTCCTCCAGCCAC........................................................................................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................CTCGCAGGCGGAAGTTGT.................................................................................................................................................................................................................................................................................................................................................................................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................................................................................CTCCTTGCCCAGCACCTT........................................................................................................................................................................................................................ | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................CTTCAGGATGAACTGGGAGCAGC............................................................................................................................................................................................................................................................................. | 23 | 1 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................CTTCAGGATGAACTGGGAGCAGCTAACAAAGGA............................................................................................................................................................................................................................................................................. | 33 | 1 | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................................................................................................................................................................CTTCCTCTTCCCCTCTGCGA.................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................CTTCAGGATGAACTGGGAGCAGCTAA............................................................................................................................................................................................................................................................................. | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................................................................................................................................................................CCCCTCTTCCTTCTCCAAC............................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................CCTCCTCACCTTCCTGAGCTTGCCCCACTC.................................................................................................................................................................................................................................................................................................................. | 30 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................................................................................................TAAGGGCTGGAGGAATGTAGCTTA...................................................................................................................................................................... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................CAGGATGAACTGGGAGCA................................................................................................................................................................................................................................................................................ | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................GAGCTTGCCCCACTCCATGGG............................................................................................................................................................................................................................................................................................................ | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .CTTGTTGATGACGTCCAG................................................................................................................................................................................................................................................................................................................................................................................................................ | 18 | 1 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................................................................................ACATTCCTCCAGCCCTTGGCA................................................................................................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................................................................................................................TCTCTAAGGGCTGGAGGAATGTAGC.................................................................................................................................................................. | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................................................................AGCTACATTCCTCCAGCCCT........................................................................................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................AGGAAAGGGGCTTCAGGA................................................................................................................................................................................................................................................................... | 18 | 2 | 0.50 | 0.50 | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................................................................CCAGCCCTTAGAGACGT............................................................................................................................................................... | 17 | 0.40 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | 0.20 | - | - | |
| ...................................................................................................................................................................................................................................................CCAGCCCTTAGAGACGTCG............................................................................................................................................................. | 19 | 0.40 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | 0.20 | - | |
| ...............................................................................................................CTAACAAAGGACTTGGA................................................................................................................................................................................................................................................................................................... | 17 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................................................................CCAGCCCTTAGAGACGTC.............................................................................................................................................................. | 18 | 0.20 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | |
| ...................................................................................................................................................................................................................................................GTCTCTAAGGGCTGG................................................................................................................................................................. | 15 | 5 | 0.20 | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - |
| ...............................................................................................................................TGAACTGGGAGCAGC..................................................................................................................................................................................................................................................................................... | 15 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 |