| (2) AGO2.ip | (1) BRAIN | (1) BREAST | (7) CELL-LINE | (9) CERVIX | (8) HEART | (2) HELA | (2) LIVER | (3) OTHER | (14) SKIN |
| AAACATTTTGGATGCCTGCACATTTGCTTTGCTAGCGGCTTTAAAAAATGGTAAGCAGCCTTACAAAAAAGGCAATATTCCCACTCATGGGTTAGAATGTTGTTTTGTGAAACTTTTAATGTACATTTGCTTTCGTATGCTTCCAAATTAATGAATGTAATGCTGACATGACTTTCCAAATATAGTTGATAGTTGTATATTCTCTAACTGAATGCTCTTTAGAGTGCTGCTTTGACTGTACCCATCTACT .......................................................................................................((((.((((......((((....((((.(((((..............))))).)))).....))))...))))))))...................................................................... ...................................................................................................100......................................................................................188............................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040030(GSM532915) G013N. (cervix) | SRR040011(GSM532896) G529T. (cervix) | SRR037937(GSM510475) 293cand2. (cell line) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR037936(GSM510474) 293cand1. (cell line) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | SRR040028(GSM532913) G026N. (cervix) | SRR189783 | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM1105753INPUT(GSM1105753) small RNA sequencing data. (hela) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR189782 | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR040039(GSM532924) G531T. (cervix) | SRR040025(GSM532910) G613T. (cervix) | DRR001483(DRX001037) "Hela long cytoplasmic cell fraction, control. (hela) | SRR189786 | SRR040024(GSM532909) G613N. (cervix) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | GSM956925F181A(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (cell line) | SRR040040(GSM532925) G612N. (cervix) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR040008(GSM532893) G727N. (cervix) | SRR040022(GSM532907) G575N. (cervix) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | GSM956925Ago2D5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..................................................................................................................................................................CTGACATGACTTTCCAAAAAAC.................................................................. | 22 | 2 | 10.00 | 7.50 | 2.00 | 2.00 | 0.50 | 1.00 | 1.00 | - | - | - | - | 1.50 | - | - | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | 0.50 | - | - | - | - | - |
| ..................................................................................................................................................................CTGACATGACTTTCC......................................................................... | 15 | 7 | 8.86 | 8.86 | 2.86 | 0.57 | 1.00 | 1.43 | 1.29 | 0.43 | - | - | - | - | - | - | - | 0.43 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.29 | 0.14 | - | - | - | - | - | - | - | 0.29 | - | - |
| ..................................................................................................................................................................CTGACATGACTTTCCAAA...................................................................... | 18 | 2 | 7.50 | 7.50 | 0.50 | 1.00 | 1.50 | 0.50 | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | 0.50 | - | - | - | - | 0.50 | - | 0.50 | - | - | - | - | - | - | - |
| ..................................................................................................................................................................CTGACATGACTTTCCA........................................................................ | 16 | 3 | 6.67 | 6.67 | 2.67 | 1.33 | 1.00 | - | 0.67 | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - |
| ..................................................................................................................................................................CTGACATGACTTTCCAAAAAA................................................................... | 21 | 2 | 6.00 | 7.50 | - | - | 1.00 | 1.50 | 1.00 | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | 0.50 | - | 0.50 | - | 0.50 | - | - | - | - | - | - |
| ........................................................................................................TTGTGAAACTTTTAATGTACATTTG......................................................................................................................... | 25 | 1 | 4.00 | 4.00 | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................GACATGACTTTCCAAAAAAC.................................................................. | 20 | 5 | 3.80 | 0.20 | 0.60 | 1.20 | 0.80 | 0.20 | 0.20 | 0.20 | - | - | - | - | - | - | - | 0.40 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | - |
| .....................................................................................................................................................................ACATGACTTTCCAAAAAA................................................................... | 18 | 2.00 | 0.00 | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................TGACATGACTTTCCAAAAAAC.................................................................. | 21 | 3 | 1.33 | 1.00 | - | 0.33 | 0.33 | - | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................TTTTGTGAAACTTTTAATGTACATTTG......................................................................................................................... | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................GTAAGCAGCCTTACAAAAAAGGCAATATTCCCACTCATGGGTTAGAATGTTGTTTTGTGAAACTTTTAATGTACATTTG......................................................................................................................... | 79 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................TGGGTTAGAATGTTGATGT................................................................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................CTAGCGGCTTTAAAAAATGTAC..................................................................................................................................................................................................... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................TGACATGACTTTCCAAA...................................................................... | 17 | 3 | 1.00 | 1.00 | 0.33 | - | - | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................GCTGACATGACTTTCCAAA...................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................GACATGACTTTCCAACCAC................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................TGGGTTAGAATGTTGTTTAGTT............................................................................................................................................. | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................TGACATGACTTTCCAAAAAA................................................................... | 20 | 3 | 1.00 | 1.00 | - | - | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - |
| ..................................................................................................................................................................................................................AATGCTCTTTAGAGTGCTGCTGAC................ | 24 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................TGGGTTAGAATGTTGTTTGTTT............................................................................................................................................. | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................GAAACTTTTAATGTACATTTG......................................................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................AAACTTTTAATGTACATTTG......................................................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................GTGAAACTTTTAATGTACATTTG......................................................................................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................GACATGACTTTCCAAAAAA................................................................... | 19 | 5 | 0.80 | 0.20 | - | - | 0.20 | 0.20 | - | - | - | - | - | - | - | 0.40 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................CTGACATGACTTTCCAA....................................................................... | 17 | 2 | 0.50 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................CTGACATGACTTTCCAAAAACC.................................................................. | 22 | 2 | 0.50 | 7.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................CTGACATGACTTTCCAAC...................................................................... | 18 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................CTGACATGACTTTCCAAACA.................................................................... | 20 | 2 | 0.50 | 7.50 | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................TGACATGACTTTCCAAACATG.................................................................. | 21 | 3 | 0.33 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................GACATGACTTTCCAAA...................................................................... | 16 | 5 | 0.20 | 0.20 | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................CTTTTAATGTACATTTG......................................................................................................................... | 17 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 |
| AAACATTTTGGATGCCTGCACATTTGCTTTGCTAGCGGCTTTAAAAAATGGTAAGCAGCCTTACAAAAAAGGCAATATTCCCACTCATGGGTTAGAATGTTGTTTTGTGAAACTTTTAATGTACATTTGCTTTCGTATGCTTCCAAATTAATGAATGTAATGCTGACATGACTTTCCAAATATAGTTGATAGTTGTATATTCTCTAACTGAATGCTCTTTAGAGTGCTGCTTTGACTGTACCCATCTACT .......................................................................................................((((.((((......((((....((((.(((((..............))))).)))).....))))...))))))))...................................................................... ...................................................................................................100......................................................................................188............................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040030(GSM532915) G013N. (cervix) | SRR040011(GSM532896) G529T. (cervix) | SRR037937(GSM510475) 293cand2. (cell line) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR037936(GSM510474) 293cand1. (cell line) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | SRR040028(GSM532913) G026N. (cervix) | SRR189783 | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM1105753INPUT(GSM1105753) small RNA sequencing data. (hela) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR189782 | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR040039(GSM532924) G531T. (cervix) | SRR040025(GSM532910) G613T. (cervix) | DRR001483(DRX001037) "Hela long cytoplasmic cell fraction, control. (hela) | SRR189786 | SRR040024(GSM532909) G613N. (cervix) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | GSM956925F181A(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (cell line) | SRR040040(GSM532925) G612N. (cervix) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR040008(GSM532893) G727N. (cervix) | SRR040022(GSM532907) G575N. (cervix) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | GSM956925Ago2D5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..................................................................................................................................................................TTTGGAAAGTCATGTCAG...................................................................... | 18 | 2 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................GCTGACATGACTTTCGAA....................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................CTGACATGACTTTCCGGG...................................................................... | 18 | 7 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................CTGACATGACTTTCCAATA..................................................................... | 19 | 2 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................CACATTTGCTTTGCTGGC...................................................................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......AATGTGCAGGCATCCAAA.................................................................................................................................................................................................................................. | 18 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................TTTGGAAAGTCATGTC...................................................................... | 16 | 5 | 0.20 | 0.20 | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |