| (1) AGO2.ip | (28) B-CELL | (14) BRAIN | (4) BREAST | (17) CELL-LINE | (1) HELA | (1) LIVER | (4) OTHER | (7) SKIN | (1) TESTES | (1) XRN.ip |
| GTGGGCTAGAGATGCGACTCAGTTGGATCTATCTCTCAGAAGGCTACCTTGTAAGTAGAGTTCCACAGCTCTGGGAAGTTTGGGCGTCCTCACCCTGCAAAGTTTAGGTTCTGTGGTGTAGCGCACTGCAGTTGATTTGCTTTTTGATAGTGGGGAGGGAAGCCGGTTTGGTCCGTGTGGGCCAGCGTGGTTTGGTGGAGTCAGCTTCATAAGAGCTGGGGTCCTGTAGGTGTCTACCAGAGGCTGGTGG ...........................................................(((((((((..((..(((.((((((.((....))))..)))).))).))..))))))...)))................................................................................................................................ ...........................................................60..................................................................128........................................................................................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR015361(GSM380326) Memory B cells (MM55). (B cell) | SRR015358(GSM380323) NaÌøve B Cell (Naive39). (B cell) | SRR015363(GSM380328) Germinal Center B cell (GC40). (B cell) | SRR015360(GSM380325) Plasma B cells (PC137). (B cell) | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | SRR033726(GSM497071) Mututated CLL (CLLM633). (B cell) | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | SRR015365(GSM380330) Memory B cells (MM139). (B cell) | SRR015359(GSM380324) Germinal Center B cell (GC136). (B cell) | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line) | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | SRR015364(GSM380329) Plasma B cells (PC44). (B cell) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | SRR033718(GSM497063) Multiple Myeloma (U266). (B cell) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR033724(GSM497069) L428 cell line (L428). (B cell) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | GSM450598(GSM450598) miRNA sequencing raw reads from post-mortem s. (brain) | GSM450606(GSM450606) miRNA sequencing raw reads from post-mortem s. (brain) | SRR037936(GSM510474) 293cand1. (cell line) | GSM450604(GSM450604) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033716(GSM497061) Mentle Cell Lymphoma (MCL114). (B cell) | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | GSM450609(GSM450609) miRNA sequencing raw reads from post-mortem s. (brain) | GSM450600(GSM450600) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR189784 | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | GSM450607(GSM450607) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033710(GSM497055) GCB DLBCL (GCB385). (B cell) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR444052(SRX128900) Sample 12cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | GSM450610(GSM450610) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR553576(SRX182782) source: Testis. (testes) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | GSM450597(GSM450597) miRNA sequencing raw reads from post-mortem s. (brain) | SRR039191(GSM494810) PBMCs were isolated by ficoll gradient from t. (blood) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | GSM450603(GSM450603) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033732(GSM497077) bjab cell line (bjab103). (B cell) | SRR038859(GSM458542) MM386. (cell line) | SRR039637(GSM518474) THP1_total_sRNAs. (cell line) | SRR037937(GSM510475) 293cand2. (cell line) | SRR038858(GSM458541) MEL202. (cell line) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR038854(GSM458537) MM653. (cell line) | SRR037932(GSM510470) 293cand4_rep1. (cell line) | TAX577590(Rovira) total RNA. (breast) | SRR390723(GSM850202) total small RNA. (cell line) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | TAX577738(Rovira) total RNA. (breast) | SRR033714(GSM497059) Burkitt Lymphoma (BL134). (B cell) | SRR060986(GSM569190) Human memory B cell [09-001]. (cell line) | SRR038862(GSM458545) MM472. (cell line) | SRR033731(GSM497076) h929 Cell line (h929). (B cell) | TAX577743(Rovira) total RNA. (breast) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..........................................................................................................GGTTCTGTGGTGTAGTGG.............................................................................................................................. | 18 | 3 | 99.33 | 1.67 | 11.67 | 6.00 | 6.33 | 3.67 | 3.67 | 4.67 | 3.67 | 4.00 | 3.33 | 3.00 | 4.33 | 3.00 | 2.00 | 2.33 | - | 2.67 | 2.00 | 3.00 | 2.00 | - | 2.33 | - | 1.33 | 1.00 | - | 1.33 | 1.33 | 2.00 | 1.00 | 0.67 | 1.00 | 0.67 | 1.00 | 0.67 | 1.33 | - | - | - | - | - | 1.00 | 0.67 | 0.33 | - | - | - | 0.67 | - | 1.00 | - | - | - | - | 0.67 | 1.00 | 1.00 | 0.33 | 0.67 | 0.33 | 0.33 | 0.67 | 0.33 | 0.33 | - | 0.33 | 0.33 | 0.33 | 0.33 | - | - | 0.33 | 0.33 | 0.33 | - | - | 0.33 | 0.33 | - |
| ..........................................................................................................GGTTCTGTGGTGTAGTGGT............................................................................................................................. | 19 | 3 | 25.67 | 1.67 | - | 2.00 | - | 1.67 | 2.33 | 1.33 | 2.33 | 1.67 | 1.00 | 1.67 | 0.33 | 0.33 | 1.67 | 1.00 | - | 0.67 | 0.33 | - | 1.00 | - | 0.33 | - | 1.00 | - | - | - | 0.67 | - | 0.33 | 0.67 | 0.33 | - | - | 0.67 | - | - | - | - | - | - | - | 0.33 | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - |
| ..........................................................................................................GGTTCTGTGGTGTAGTG............................................................................................................................... | 17 | 3 | 4.67 | 1.67 | - | 0.33 | - | 1.00 | - | - | - | - | 0.33 | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.67 | - | - | 0.33 | 0.33 | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................GTGGGGAGGGAAGCCGGTTTGGTCCGTGTGGG..................................................................... | 32 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................CTATCTCTCAGAAGGCTACC.......................................................................................................................................................................................................... | 20 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................GGTTCTGTGGTGTAG................................................................................................................................. | 15 | 3 | 1.67 | 1.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - |
| ..........................................................................................................GGTTCTGTGGTGTAGTCAT............................................................................................................................. | 19 | 3 | 1.33 | 1.67 | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................CAGTTGGATCTATCTCTCAGAAGG............................................................................................................................................................................................................... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................GTTTAGGTTCTGTGGTGTAGCGCACTG.......................................................................................................................... | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................TCAGTTGGATCTATCTCTCAGAAGGC.............................................................................................................................................................................................................. | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................TTAGGTTCTGTGGTGTAGCGCACTGCAGCT..................................................................................................................... | 30 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................................................ATAAGAGCTGGGGTCCTGTAGGTGTCCACC............ | 30 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................GGTTCTGTGGTGTAGCAGTC............................................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................................................................TTCATAAGAGCTGGGGTCCTGTAG..................... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................ACAGCTCTGGGAAGTTTGGGCGTC.................................................................................................................................................................. | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................................................GAGCTGGGGTCCTGTAGGTGTCTACCAGAGGC...... | 32 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................AGTTGGATCTATCTCTCAGGACG............................................................................................................................................................................................................... | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................GGTTCTGTGGTGTAGCGG.............................................................................................................................. | 18 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................................................................GGTCCTGTAGGTGTCGCCA............ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................TTGATAGTGGGGAGGGAAGCCGGTCCGG............................................................................... | 28 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................CAGTTGGATCTATCTCTCAGAAG................................................................................................................................................................................................................ | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................................................AAGAGCTGGGGTCCTGTAGGTGTCTACCA........... | 29 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................GGTTCTGTGGTGTAGTGGA............................................................................................................................. | 19 | 3 | 0.67 | 1.67 | 0.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................GGTTCTGTGGTGTAGTGT.............................................................................................................................. | 18 | 3 | 0.67 | 1.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................GGTTCTGTGGTGTAGTAG.............................................................................................................................. | 18 | 3 | 0.33 | 1.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................GGTTCTGTGGTGTAGTGAA............................................................................................................................. | 19 | 3 | 0.33 | 1.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - |
| ..........................................................................................................GGTTCTGTGGTGTAGGGGT............................................................................................................................. | 19 | 3 | 0.33 | 1.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................GGTTCTGTGGTGTAGTGAT............................................................................................................................. | 19 | 3 | 0.33 | 1.67 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................GGTTCTGTGGTGTAGTTG.............................................................................................................................. | 18 | 3 | 0.33 | 1.67 | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................ATTTGCTTTTTGATAGTG.................................................................................................. | 18 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 |
| GTGGGCTAGAGATGCGACTCAGTTGGATCTATCTCTCAGAAGGCTACCTTGTAAGTAGAGTTCCACAGCTCTGGGAAGTTTGGGCGTCCTCACCCTGCAAAGTTTAGGTTCTGTGGTGTAGCGCACTGCAGTTGATTTGCTTTTTGATAGTGGGGAGGGAAGCCGGTTTGGTCCGTGTGGGCCAGCGTGGTTTGGTGGAGTCAGCTTCATAAGAGCTGGGGTCCTGTAGGTGTCTACCAGAGGCTGGTGG ...........................................................(((((((((..((..(((.((((((.((....))))..)))).))).))..))))))...)))................................................................................................................................ ...........................................................60..................................................................128........................................................................................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR015361(GSM380326) Memory B cells (MM55). (B cell) | SRR015358(GSM380323) NaÌøve B Cell (Naive39). (B cell) | SRR015363(GSM380328) Germinal Center B cell (GC40). (B cell) | SRR015360(GSM380325) Plasma B cells (PC137). (B cell) | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | SRR033726(GSM497071) Mututated CLL (CLLM633). (B cell) | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | SRR015365(GSM380330) Memory B cells (MM139). (B cell) | SRR015359(GSM380324) Germinal Center B cell (GC136). (B cell) | SRR039193(GSM494812) HL60 cell line is derived from acute promyelo. (cell line) | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | SRR015364(GSM380329) Plasma B cells (PC44). (B cell) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | SRR033718(GSM497063) Multiple Myeloma (U266). (B cell) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR033724(GSM497069) L428 cell line (L428). (B cell) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | GSM450598(GSM450598) miRNA sequencing raw reads from post-mortem s. (brain) | GSM450606(GSM450606) miRNA sequencing raw reads from post-mortem s. (brain) | SRR037936(GSM510474) 293cand1. (cell line) | GSM450604(GSM450604) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033716(GSM497061) Mentle Cell Lymphoma (MCL114). (B cell) | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | GSM450609(GSM450609) miRNA sequencing raw reads from post-mortem s. (brain) | GSM450600(GSM450600) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR189784 | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | GSM450607(GSM450607) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033710(GSM497055) GCB DLBCL (GCB385). (B cell) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR444052(SRX128900) Sample 12cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | GSM450610(GSM450610) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR553576(SRX182782) source: Testis. (testes) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | GSM450597(GSM450597) miRNA sequencing raw reads from post-mortem s. (brain) | SRR039191(GSM494810) PBMCs were isolated by ficoll gradient from t. (blood) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | GSM450603(GSM450603) miRNA sequencing raw reads from post-mortem s. (brain) | SRR033732(GSM497077) bjab cell line (bjab103). (B cell) | SRR038859(GSM458542) MM386. (cell line) | SRR039637(GSM518474) THP1_total_sRNAs. (cell line) | SRR037937(GSM510475) 293cand2. (cell line) | SRR038858(GSM458541) MEL202. (cell line) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR038854(GSM458537) MM653. (cell line) | SRR037932(GSM510470) 293cand4_rep1. (cell line) | TAX577590(Rovira) total RNA. (breast) | SRR390723(GSM850202) total small RNA. (cell line) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | TAX577738(Rovira) total RNA. (breast) | SRR033714(GSM497059) Burkitt Lymphoma (BL134). (B cell) | SRR060986(GSM569190) Human memory B cell [09-001]. (cell line) | SRR038862(GSM458545) MM472. (cell line) | SRR033731(GSM497076) h929 Cell line (h929). (B cell) | TAX577743(Rovira) total RNA. (breast) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ............TGCGACTCAGTTGGACCC............................................................................................................................................................................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................................................CTACAGGACCCCAGCTCTTAT..................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............TAGATCCAACTGAGTC........................................................................................................................................................................................................................... | 16 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................CTTCTGAGAGATAGATCCAACTGA................................................................................................................................................................................................................ | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................GATTTGCTTTTTGATACAG.................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................CAAATCAACTGCAGTG............................................................................................................... | 16 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |