| (2) AGO1.ip | (2) AGO2.ip | (1) AGO3.ip | (6) B-CELL | (3) BRAIN | (6) BREAST | (25) CELL-LINE | (3) CERVIX | (4) HEART | (3) HELA | (14) LIVER | (2) OTHER | (1) RRP40.ip | (11) SKIN | (1) TESTES | (4) UTERUS | (1) XRN.ip |
| GTGGTTGAAAAGGTCTCTGTATAGGTACATATGTGCATCTTTCCCTGGAAGAGGGTCTGTAACTTCTTAAAAGGATACAAAGCCCTCAAGGGTTAAGAACCTTTGTACAGGCTTCTCTCAAGTGGGCCAATTTGGTACCTATATCTAGGTAGCATCTGGAGACTGGGAGTGTTTATTCATGACAGTTCCGTCTCCTACAGCTATTTCCTTCGTGCTACCATCAGCCGCCGCCTCAATGATGTTGTCAAAG ..........................................................................................(((.....))).......((((..(((((.(((...(((...((.((((((....)))))).))..)))..)))))))).))))............................................................................ ..........................................................................................91........................................................................................181................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | GSM1105750AGO3(GSM1105750) small RNA sequencing data. (ago3 hela) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR189785 | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | GSM1105748AGO1(GSM1105748) small RNA sequencing data. (ago1 hela) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR039615(GSM531978) Severe Chronic Hepatitis B Liver Tissue. (liver) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | SRR039618(GSM531981) HBV(+) Side Tissue Sample 1. (liver) | SRR095854(SRX039177) "miRNA were isolated from FirstChoice Human B. (brain) | SRR039636(GSM518473) THP1_cyto_sRNAs. (cell line) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR040014(GSM532899) G623N. (cervix) | GSM450600(GSM450600) miRNA sequencing raw reads from post-mortem s. (brain) | SRR039613(GSM531976) Human Normal Liver Tissue Sample 3. (liver) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR038853(GSM458536) MELB. (cell line) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR038856(GSM458539) D11. (cell line) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR039624(GSM531987) HBV(-) HCV(-) Adjacent Tissue Sample. (liver) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR189784 | SRR040040(GSM532925) G612N. (cervix) | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR037935(GSM510473) 293cand3. (cell line) | SRR039614(GSM531977) HBV-infected Liver Tissue. (liver) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | GSM450607(GSM450607) miRNA sequencing raw reads from post-mortem s. (brain) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR343332(GSM796035) "KSHV (HHV8), EBV (HHV-4)". (cell line) | SRR207113(GSM721075) IP against AGO 1 & 2. (ago1/2 cell line) | SRR191566(GSM715676) 94genomic small RNA (size selected RNA from t. (breast) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | GSM1105753INPUT(GSM1105753) small RNA sequencing data. (hela) | SRR060984(GSM569188) Human plasma cell [09-001]. (cell line) | SRR189782 | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver) | SRR038855(GSM458538) D10. (cell line) | SRR039612(GSM531975) Human Normal Liver Tissue Sample 2. (liver) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | TAX577739(Rovira) total RNA. (breast) | TAX577590(Rovira) total RNA. (breast) | SRR033715(GSM497060) Mantle Cell Lymphoma (Mino122). (B cell) | SRR553576(SRX182782) source: Testis. (testes) | SRR038860(GSM458543) MM426. (cell line) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR060168(GSM565978) 5-8F_nucleus. (cell line) | TAX577744(Rovira) total RNA. (breast) | SRR060169(GSM565979) 5-8F_cytoplasm. (cell line) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR033728(GSM497073) MALT (MALT413). (B cell) | TAX577453(Rovira) total RNA. (breast) | SRR038862(GSM458545) MM472. (cell line) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033729(GSM497074) splenic MZL (Splenic414). (B cell) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR039611(GSM531974) Human Normal Liver Tissue Sample 1. (liver) | SRR040008(GSM532893) G727N. (cervix) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189777(GSM714637) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..........................................................................................................................................................TCTGGAGACTGGGAGTGTTTATT......................................................................... | 23 | 1 | 43.00 | 43.00 | 10.00 | - | - | 1.00 | - | 1.00 | - | 2.00 | - | 2.00 | 3.00 | - | 2.00 | - | - | - | 1.00 | - | - | - | 1.00 | - | 1.00 | 2.00 | - | - | 1.00 | 2.00 | - | 2.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | 1.00 | 1.00 | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - |
| ..........................................................................................................................................................TCTGGAGACTGGGAGTGTTTAT.......................................................................... | 22 | 1 | 34.00 | 34.00 | 5.00 | - | - | 2.00 | 2.00 | 1.00 | - | 1.00 | 2.00 | - | - | 2.00 | - | - | 1.00 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | 2.00 | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | 1.00 | 1.00 | - | - | 1.00 | - | - | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - |
| ..........................................................................................................................................................TCTGGAGACTGGGAGTGTTT............................................................................ | 20 | 1 | 17.00 | 17.00 | - | 7.00 | 2.00 | 1.00 | - | - | - | - | 2.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................TCTGGAGACTGGGAGTGTTTATTC........................................................................ | 24 | 1 | 14.00 | 14.00 | 3.00 | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | 1.00 | 2.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................TCTGGAGACTGGGAGTGTT............................................................................. | 19 | 1 | 11.00 | 11.00 | - | 4.00 | 2.00 | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................TCTGGAGACTGGGAGTGTTTA........................................................................... | 21 | 1 | 8.00 | 8.00 | 2.00 | - | 3.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................TCTGGAGACTGGGAGTGTTTATTCA....................................................................... | 25 | 1 | 4.00 | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................TCTGGAGACTGGGAGTGTTTATTT........................................................................ | 24 | 1 | 4.00 | 43.00 | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................CAAGTGGGCCAATTT..................................................................................................................... | 15 | 2 | 3.00 | 3.00 | - | - | - | - | - | - | 1.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | 0.50 | - | 0.50 |
| ..........................................................................................................................................................TCTGGAGACTGGGAGTGTAA............................................................................ | 20 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................TGGAGACTGGGAGTGTTTATTCA....................................................................... | 23 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................................................ATCTGGAGACTGGGAGTGTTT............................................................................ | 21 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................TCTGGAGACTGGGAGTGT.............................................................................. | 18 | 1 | 2.00 | 2.00 | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................TCTGGAGACTGGGAGTGTTA............................................................................ | 20 | 1 | 2.00 | 11.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................TGGAGACTGGGAGTGTTTAT.......................................................................... | 20 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................TCTGGAGACTGGGAGTGTTTATTTAT...................................................................... | 26 | 1 | 1.00 | 43.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................TCTGGAGACTGGGAGTGTTAA........................................................................... | 21 | 1 | 1.00 | 11.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................................................CGTGCTACCATCAGCCGCCGCCTCAATGATGTTG...... | 34 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................AGAACCTTTGTACAGGCC......................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................................................ATCTGGAGACTGGGAGTGTTTAT.......................................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................GGTAGCATCTGGAGACTGGGA.................................................................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................CTGGAAGAGGGTCTGTAGGG.......................................................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................TGGAGACTGGGAGTGTTTATTCAT...................................................................... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................TCTGGAGACTGGGAGTGTTTATTCAT...................................................................... | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................TGGAGACTGGGAGTGTTTATT......................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................TCTGGAGACTGGGAGTGTTTG........................................................................... | 21 | 1 | 1.00 | 17.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................TCTGGAGACTGGGAGTGTTAAG.......................................................................... | 22 | 1 | 1.00 | 11.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................................................TTCGTGCTACCATCAGCCGCCG.................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................CTGGAGACTGGGAGTGTTTAT.......................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........AAAGGTCTCTGTATAATAG............................................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................AGTGGGCCAATTTGGGCAC............................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................TCTGGAGACTGGGAGTGTTTATTCATGACAG................................................................. | 31 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................CTGGGAGTGTTTATTAGAC..................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................GGAAGAGGGTCTGTAACTTCATA..................................................................................................................................................................................... | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................CTGGAGACTGGGAGTGTTTATT......................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................CTGGAGACTGGGAGTGTTT............................................................................ | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................TCTGGAGACTGGGAGTGTTTT........................................................................... | 21 | 1 | 1.00 | 17.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................TGGGAGTGTTTATTCTCA..................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................CAAGTGGGCCAATTTTGG.................................................................................................................. | 18 | 2 | 0.50 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - |
| ......................................................................................................................CAAGTGGGCCAATTTTTGT................................................................................................................. | 19 | 2 | 0.50 | 3.00 | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| GTGGTTGAAAAGGTCTCTGTATAGGTACATATGTGCATCTTTCCCTGGAAGAGGGTCTGTAACTTCTTAAAAGGATACAAAGCCCTCAAGGGTTAAGAACCTTTGTACAGGCTTCTCTCAAGTGGGCCAATTTGGTACCTATATCTAGGTAGCATCTGGAGACTGGGAGTGTTTATTCATGACAGTTCCGTCTCCTACAGCTATTTCCTTCGTGCTACCATCAGCCGCCGCCTCAATGATGTTGTCAAAG ..........................................................................................(((.....))).......((((..(((((.(((...(((...((.((((((....)))))).))..)))..)))))))).))))............................................................................ ..........................................................................................91........................................................................................181................................................................... | Size | Perfect hit | Total Norm | Perfect Norm | GSM1105750AGO3(GSM1105750) small RNA sequencing data. (ago3 hela) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR189785 | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | GSM1105748AGO1(GSM1105748) small RNA sequencing data. (ago1 hela) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR039615(GSM531978) Severe Chronic Hepatitis B Liver Tissue. (liver) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | SRR039618(GSM531981) HBV(+) Side Tissue Sample 1. (liver) | SRR095854(SRX039177) "miRNA were isolated from FirstChoice Human B. (brain) | SRR039636(GSM518473) THP1_cyto_sRNAs. (cell line) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR040014(GSM532899) G623N. (cervix) | GSM450600(GSM450600) miRNA sequencing raw reads from post-mortem s. (brain) | SRR039613(GSM531976) Human Normal Liver Tissue Sample 3. (liver) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR038853(GSM458536) MELB. (cell line) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR038856(GSM458539) D11. (cell line) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR039624(GSM531987) HBV(-) HCV(-) Adjacent Tissue Sample. (liver) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR189784 | SRR040040(GSM532925) G612N. (cervix) | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR037935(GSM510473) 293cand3. (cell line) | SRR039614(GSM531977) HBV-infected Liver Tissue. (liver) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | GSM450607(GSM450607) miRNA sequencing raw reads from post-mortem s. (brain) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR343332(GSM796035) "KSHV (HHV8), EBV (HHV-4)". (cell line) | SRR207113(GSM721075) IP against AGO 1 & 2. (ago1/2 cell line) | SRR191566(GSM715676) 94genomic small RNA (size selected RNA from t. (breast) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | GSM1105753INPUT(GSM1105753) small RNA sequencing data. (hela) | SRR060984(GSM569188) Human plasma cell [09-001]. (cell line) | SRR189782 | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver) | SRR038855(GSM458538) D10. (cell line) | SRR039612(GSM531975) Human Normal Liver Tissue Sample 2. (liver) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | TAX577739(Rovira) total RNA. (breast) | TAX577590(Rovira) total RNA. (breast) | SRR033715(GSM497060) Mantle Cell Lymphoma (Mino122). (B cell) | SRR553576(SRX182782) source: Testis. (testes) | SRR038860(GSM458543) MM426. (cell line) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR060168(GSM565978) 5-8F_nucleus. (cell line) | TAX577744(Rovira) total RNA. (breast) | SRR060169(GSM565979) 5-8F_cytoplasm. (cell line) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR033728(GSM497073) MALT (MALT413). (B cell) | TAX577453(Rovira) total RNA. (breast) | SRR038862(GSM458545) MM472. (cell line) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033729(GSM497074) splenic MZL (Splenic414). (B cell) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR039611(GSM531974) Human Normal Liver Tissue Sample 1. (liver) | SRR040008(GSM532893) G727N. (cervix) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189777(GSM714637) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .........................................................................................................TACAGGCTTCTCTCAGCT............................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................TGAGAGAAGCCTGTACAA.................................................................................................................................. | 18 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - |