| (2) AGO2.ip | (2) B-CELL | (1) BRAIN | (18) BREAST | (17) CELL-LINE | (1) CERVIX | (3) HEART | (2) HELA | (3) LIVER | (6) OTHER | (62) SKIN | (1) TESTES | (1) UTERUS | (1) XRN.ip |
| GGTGAAGTAGAAGTAGGAATTTTGTTTGTTTTATGAAGTAGGTAAGCACTGATAATTTGAGCTAGGTCATCCAGTGCCTTTAATTACTTATCTGAGCCATCTCAGAGTTTTTGAAATGCTAAACAAGACCAAACATTCAATAATAAACCATTATTCTAATTTGTATTAAAATATATTAAAACAAAGCATTTTTTTTACAGGAGAATTTTGGCTAGGACTGAAAAAGATTTTTTATATAGTAAATCAGAAA ...............................................................................................................................................................(((((.((((......)))).)))))................................................................. ..............................................................................................................................127......................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR343334 | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189785 | SRR037941(GSM510479) 293DroshaTN. (cell line) | SRR029130(GSM416759) DLD2. (cell line) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR189784 | SRR189782 | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR037936(GSM510474) 293cand1. (cell line) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR037943(GSM510481) 293DcrTN. (cell line) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR029124(GSM416753) HeLa. (hela) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR553576(SRX182782) source: Testis. (testes) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR037935(GSM510473) 293cand3. (cell line) | SRR444046(SRX128894) Sample 7cDNABarcode: AF-PP-342: ACG CTC TTC C. (skin) | SRR189783 | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR343336 | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR029128(GSM416757) H520. (cell line) | SRR330875(SRX091713) tissue: skin psoriatic involveddisease state:. (skin) | SRR390723(GSM850202) total small RNA. (cell line) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR191410(GSM715520) 20genomic small RNA (size selected RNA from t. (breast) | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | TAX577580(Rovira) total RNA. (breast) | SRR191555(GSM715665) 195genomic small RNA (size selected RNA from . (breast) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191462(GSM715572) 1genomic small RNA (size selected RNA from to. (breast) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191581(GSM715691) 104genomic small RNA (size selected RNA from . (breast) | SRR191630(GSM715740) 70genomic small RNA (size selected RNA from t. (breast) | SRR191425(GSM715535) 141genomic small RNA (size selected RNA from . (breast) | SRR191408(GSM715518) 88genomic small RNA (size selected RNA from t. (breast) | TAX577740(Rovira) total RNA. (breast) | SRR015358(GSM380323) NaÌøve B Cell (Naive39). (B cell) | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR191620(GSM715730) 167genomic small RNA (size selected RNA from . (breast) | GSM532884(GSM532884) G871T. (cervix) | GSM450610(GSM450610) miRNA sequencing raw reads from post-mortem s. (brain) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin) | SRR191635(GSM715745) 9genomic small RNA (size selected RNA from to. (breast) | SRR037934(GSM510472) 293cand4_rep3. (cell line) | TAX577744(Rovira) total RNA. (breast) | TAX577589(Rovira) total RNA. (breast) | TAX577738(Rovira) total RNA. (breast) | SRR444054(SRX128902) Sample 14cDNABarcode: AF-PP-342: ACG CTC TTC . (skin) | SRR191623(GSM715733) 18genomic small RNA (size selected RNA from t. (breast) | SRR029131(GSM416760) MCF7. (cell line) | GSM956925Ago2PAZ(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR191402(GSM715512) 43genomic small RNA (size selected RNA from t. (breast) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577745(Rovira) total RNA. (breast) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039611(GSM531974) Human Normal Liver Tissue Sample 1. (liver) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..............................................................................................................................................................................ATTAAAACAAAGCATCGCG......................................................... | 19 | 0 | 392.00 | 1.00 | 123.00 | 32.00 | 12.00 | 16.00 | 15.00 | 11.00 | 7.00 | 13.00 | 9.00 | 8.00 | 6.00 | 6.00 | 5.00 | 4.00 | 5.00 | 7.00 | 5.00 | 5.00 | 2.00 | 5.00 | 5.00 | 4.00 | 6.00 | - | - | 6.00 | 2.00 | 4.00 | 1.00 | - | - | 3.00 | 4.00 | 1.00 | - | 3.00 | 3.00 | 1.00 | 2.00 | 4.00 | 4.00 | - | - | - | 2.00 | 1.00 | 1.00 | - | 3.00 | 2.00 | 1.00 | - | 1.00 | - | 2.00 | - | 2.00 | - | 2.00 | - | 1.00 | 1.00 | 2.00 | 1.00 | - | - | 2.00 | - | - | 2.00 | - | - | 1.00 | - | 1.00 | 1.00 | 1.00 | - | 1.00 | - | - | - | - | 1.00 | - | 1.00 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | 1.00 | 1.00 | - | 1.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | 1.00 | - | - | - |
| ..............................................................................................................................................................................ATTAAAACAAAGCATCGC.......................................................... | 18 | 0 | 97.00 | 1.00 | 1.00 | 6.00 | 6.00 | 3.00 | 3.00 | 5.00 | 2.00 | - | 3.00 | 2.00 | 3.00 | 1.00 | 4.00 | 4.00 | - | - | 1.00 | 2.00 | - | - | - | 1.00 | - | - | - | - | 3.00 | 2.00 | 1.00 | - | - | - | - | 2.00 | 5.00 | 1.00 | - | 3.00 | - | - | - | 3.00 | 3.00 | 3.00 | - | - | 1.00 | - | - | 1.00 | 1.00 | 1.00 | 1.00 | 2.00 | - | - | - | - | - | 2.00 | 1.00 | 1.00 | - | - | - | - | - | 2.00 | 2.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | 1.00 |
| ..............................................................................................................................................................................ATTAAAACAAAGCATCG........................................................... | 17 | 0 | 96.00 | 1.00 | 42.00 | 8.00 | 5.00 | 2.00 | - | - | 4.00 | - | 1.00 | 1.00 | 2.00 | 3.00 | 1.00 | - | 3.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | 3.00 | - | - | 1.00 | - | - | - | - | 1.00 | - | 2.00 | - | - | - | - | - | 1.00 | 2.00 | 1.00 | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - |
| ..............................................................................................................................................................................ATTAAAACAAAGCATTGC.......................................................... | 18 | 12.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | 2.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................ATTAAAACAAAGCATTGCGA........................................................ | 20 | 8.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................................................TTAAAACAAAGCATTGCGA........................................................ | 19 | 7.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 6.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................................................TTAAAACAAAGCATTGCG......................................................... | 18 | 5.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | |
| ..............................................................................................................................................................................ATTAAAACAAAGCATTGCG......................................................... | 19 | 5.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................................................TTAAAACAAAGCATTGC.......................................................... | 17 | 3.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................................TATTAAAACAAAGCATCGCG......................................................... | 20 | 3.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | |
| ...................................................................................................................................AACATTCAATAATAAAAG..................................................................................................... | 18 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................................AGGAGAATTTTGGCTTCTC................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................................TATTAAAACAAAGCATCG........................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................................................................................................AGAATTTTGGCTAGGAATCT............................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................................................TTAAAACAAAGCATTTCGA........................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................................................................TTTTGGCTAGGACTGAAA........................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................................................GGCTAGGACTGAAAAAGATTT.................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - |
| ............................................................................................................................................TAATAAACCATTATTCCAC........................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................TTTTGTTTGTTTTATGAATGGT................................................................................................................................................................................................................. | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................................................................GGCTAGGACTGAAAAAGA....................... | 18 | 1 | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................ATTAAAACAAAGCATTTCGA........................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................ATTAAAACAAAGCATCGTG......................................................... | 19 | 0 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................................................AGGAGAATTTTGGCTAGGAC................................ | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................ATTAAAACAAAGCATCGCA......................................................... | 19 | 0 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................................TATTAAAACAAAGCATCGC.......................................................... | 19 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................................................CTAGGACTGAAAAAGATTTTTTATAT............. | 26 | 1 | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................................................................ATTTTGGCTAGGACTGAAA........................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................ATTAAAACAAAGCATCAGC......................................................... | 19 | 0 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................................................AATTTTGGCTAGGACTGAAAAAGATTTTTTAT............... | 32 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................ATTAAAACAAAGCAT............................................................. | 15 | 0 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - |
| GGTGAAGTAGAAGTAGGAATTTTGTTTGTTTTATGAAGTAGGTAAGCACTGATAATTTGAGCTAGGTCATCCAGTGCCTTTAATTACTTATCTGAGCCATCTCAGAGTTTTTGAAATGCTAAACAAGACCAAACATTCAATAATAAACCATTATTCTAATTTGTATTAAAATATATTAAAACAAAGCATTTTTTTTACAGGAGAATTTTGGCTAGGACTGAAAAAGATTTTTTATATAGTAAATCAGAAA ...............................................................................................................................................................(((((.((((......)))).)))))................................................................. ..............................................................................................................................127......................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR343334 | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189785 | SRR037941(GSM510479) 293DroshaTN. (cell line) | SRR029130(GSM416759) DLD2. (cell line) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR189784 | SRR189782 | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR037936(GSM510474) 293cand1. (cell line) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR037943(GSM510481) 293DcrTN. (cell line) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR029124(GSM416753) HeLa. (hela) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR553576(SRX182782) source: Testis. (testes) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR037935(GSM510473) 293cand3. (cell line) | SRR444046(SRX128894) Sample 7cDNABarcode: AF-PP-342: ACG CTC TTC C. (skin) | SRR189783 | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR343336 | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR029128(GSM416757) H520. (cell line) | SRR330875(SRX091713) tissue: skin psoriatic involveddisease state:. (skin) | SRR390723(GSM850202) total small RNA. (cell line) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR191410(GSM715520) 20genomic small RNA (size selected RNA from t. (breast) | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | TAX577580(Rovira) total RNA. (breast) | SRR191555(GSM715665) 195genomic small RNA (size selected RNA from . (breast) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191462(GSM715572) 1genomic small RNA (size selected RNA from to. (breast) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191581(GSM715691) 104genomic small RNA (size selected RNA from . (breast) | SRR191630(GSM715740) 70genomic small RNA (size selected RNA from t. (breast) | SRR191425(GSM715535) 141genomic small RNA (size selected RNA from . (breast) | SRR191408(GSM715518) 88genomic small RNA (size selected RNA from t. (breast) | TAX577740(Rovira) total RNA. (breast) | SRR015358(GSM380323) NaÌøve B Cell (Naive39). (B cell) | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR191620(GSM715730) 167genomic small RNA (size selected RNA from . (breast) | GSM532884(GSM532884) G871T. (cervix) | GSM450610(GSM450610) miRNA sequencing raw reads from post-mortem s. (brain) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR330860(SRX091698) tissue: skin psoriatic involveddisease state:. (skin) | SRR191635(GSM715745) 9genomic small RNA (size selected RNA from to. (breast) | SRR037934(GSM510472) 293cand4_rep3. (cell line) | TAX577744(Rovira) total RNA. (breast) | TAX577589(Rovira) total RNA. (breast) | TAX577738(Rovira) total RNA. (breast) | SRR444054(SRX128902) Sample 14cDNABarcode: AF-PP-342: ACG CTC TTC . (skin) | SRR191623(GSM715733) 18genomic small RNA (size selected RNA from t. (breast) | SRR029131(GSM416760) MCF7. (cell line) | GSM956925Ago2PAZ(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR191402(GSM715512) 43genomic small RNA (size selected RNA from t. (breast) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577745(Rovira) total RNA. (breast) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039611(GSM531974) Human Normal Liver Tissue Sample 1. (liver) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ......................................................................................................CAGAGTTTTTGAAATGATC................................................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .GTGAAGTAGAAGTAGTTTA...................................................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |