| (1) BRAIN | (14) BREAST | (10) CELL-LINE | (4) CERVIX | (3) HEART | (7) LIVER | (3) OTHER | (21) SKIN | (1) TESTES |
| TCAACATCTGCGCCATCGAGGACATCGGCTACCTGCCGTCCGAGGGCACGGTGAGTGCGGGCGGCCGCGACCCGGGCGGGAGGGCCGCGCACCTGCGCCTTGGCGAGGGCGGGAACCGGGCGGCGGCAGGGCCTCCTGGGACCCCAGGGCGGGGGCCGCACCCTCCGCGCAGGGTTCGCGGCGCCCACCCGCGCACGTGCGTGCCGGGAAGGGCGCGCCGGCCCTGGCCAAGTGCGTGCGCCCCGCCTGC ............................................................................................................(((((..(((((.(((......))).)))))..)))..(((.(((.((((((((((......)))))..))))).))).)))..))........................................................ .........................................................................................................106...........................................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | TAX577589(Rovira) total RNA. (breast) | TAX577746(Rovira) total RNA. (breast) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | TAX577579(Rovira) total RNA. (breast) | TAX577738(Rovira) total RNA. (breast) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189783 | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | TAX577741(Rovira) total RNA. (breast) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | TAX577743(Rovira) total RNA. (breast) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR191552(GSM715662) 42genomic small RNA (size selected RNA from t. (breast) | GSM532876(GSM532876) G547T. (cervix) | SRR040010(GSM532895) G529N. (cervix) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR189787 | SRR330882(SRX091720) tissue: skin psoriatic uninvolveddisease stat. (skin) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR040008(GSM532893) G727N. (cervix) | SRR330875(SRX091713) tissue: skin psoriatic involveddisease state:. (skin) | SRR039612(GSM531975) Human Normal Liver Tissue Sample 2. (liver) | TAX577739(Rovira) total RNA. (breast) | SRR191549(GSM715659) 105genomic small RNA (size selected RNA from . (breast) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | TAX577590(Rovira) total RNA. (breast) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577742(Rovira) total RNA. (breast) | SRR553576(SRX182782) source: Testis. (testes) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | TAX577744(Rovira) total RNA. (breast) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR207116(GSM721078) Nuclear RNA. (cell line) | TAX577453(Rovira) total RNA. (breast) | SRR040020(GSM532905) G699N_2. (cervix) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR191571(GSM715681) 63genomic small RNA (size selected RNA from t. (breast) | SRR039611(GSM531974) Human Normal Liver Tissue Sample 1. (liver) | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR189786 | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...................................................................................................................................................................................GGCGCCCACCCGCGCGGG..................................................... | 18 | 21.00 | 0.00 | - | 3.00 | 2.00 | - | 2.00 | 1.00 | - | 1.00 | - | - | - | 1.00 | - | 2.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | 1.00 | - | 1.00 | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................CGGCGCCCACCCGCGCGGG..................................................... | 19 | 10.00 | 0.00 | - | 1.00 | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................GGCGCCCACCCGCGCGGGG.................................................... | 19 | 7.00 | 0.00 | - | 2.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................GGGAACCGGGCGGCGGC........................................................................................................................... | 17 | 2 | 3.50 | 3.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 0.50 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | 0.50 | - | - | - | - | - |
| ...............................................................................................................GGAACCGGGCGGCGGC........................................................................................................................... | 16 | 2 | 3.50 | 3.50 | - | - | - | - | - | - | - | - | 0.50 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - |
| ...................................................................................................................................................................................................................GGCGCGCCGGCCCTGGCGG.................... | 19 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................CGGCGCCCACCCGCGCG....................................................... | 17 | 2.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................GGAACCGGGCGGCGGCA.......................................................................................................................... | 17 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................CGGCGCCCACCCGCGCGG...................................................... | 18 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......CTGCGCCATCGAGGACATCGGCTA........................................................................................................................................................................................................................... | 24 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................CAGGGCGGGGGCCGCTCCA....................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............CCATCGAGGACATCGGCTA........................................................................................................................................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - |
| ........TGCGCCATCGAGGACATCGGCTT........................................................................................................................................................................................................................... | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................CGGCGCCCACCCGCGCGGGG.................................................... | 20 | 1.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........GCGCCATCGAGGACATCGGCTAAC......................................................................................................................................................................................................................... | 24 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................GCTACCTGCCGTCCGAGGGC........................................................................................................................................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........GCGCCATCGAGGACATCGGCTAA.......................................................................................................................................................................................................................... | 23 | 1.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........GCGCCATCGAGGACATCGGCTACCT........................................................................................................................................................................................................................ | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - |
| ...ACATCTGCGCCATCGAGGACATCG............................................................................................................................................................................................................................... | 24 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..AACATCTGCGCCATCGAGGACATCGGC............................................................................................................................................................................................................................. | 27 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................ACCTGCCGTCCGAGGGCACGCT...................................................................................................................................................................................................... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................TCCGAGGGCACGGTGCTGA................................................................................................................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......TCTGCGCCATCGAGGACATCGGCTACC......................................................................................................................................................................................................................... | 27 | 1 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................CGCGCACCTGCGCCTT..................................................................................................................................................... | 16 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................GGCGGGAGGGCCGCGCAGTCT........................................................................................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................GGCGCCCACCCGCGCGC...................................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........GCGCCATCGAGGACATCGGATA........................................................................................................................................................................................................................... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................GGCGGGGGCCGCACCACC..................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | |
| .........GCGCCATCGAGGACATCGGCT............................................................................................................................................................................................................................ | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............ATCGAGGACATCGGCTACC......................................................................................................................................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................CGGGCGGCGGCAGGGGACA................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......TCTGCGCCATCGAGGACATCGGCTACAT........................................................................................................................................................................................................................ | 28 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................GGCCGCGACCCGGGCCCT.......................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................TGCCGTCCGAGGGCACGC....................................................................................................................................................................................................... | 18 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................GGAACCGGGCGGCGG............................................................................................................................ | 15 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................GGGAACCGGGCGGCGG............................................................................................................................ | 16 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - |
| .............................................................................................................CGGGAACCGGGCGGC.............................................................................................................................. | 15 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - |
| .....................................................................................................................GGGCGGCGGCAGGGCC..................................................................................................................... | 16 | 5 | 0.20 | 0.20 | - | - | - | - | - | - | - | - | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................................................GCGCGCCGGCCCTGG....................... | 15 | 6 | 0.17 | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 |
| TCAACATCTGCGCCATCGAGGACATCGGCTACCTGCCGTCCGAGGGCACGGTGAGTGCGGGCGGCCGCGACCCGGGCGGGAGGGCCGCGCACCTGCGCCTTGGCGAGGGCGGGAACCGGGCGGCGGCAGGGCCTCCTGGGACCCCAGGGCGGGGGCCGCACCCTCCGCGCAGGGTTCGCGGCGCCCACCCGCGCACGTGCGTGCCGGGAAGGGCGCGCCGGCCCTGGCCAAGTGCGTGCGCCCCGCCTGC ............................................................................................................(((((..(((((.(((......))).)))))..)))..(((.(((.((((((((((......)))))..))))).))).)))..))........................................................ .........................................................................................................106...........................................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | TAX577589(Rovira) total RNA. (breast) | TAX577746(Rovira) total RNA. (breast) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | TAX577579(Rovira) total RNA. (breast) | TAX577738(Rovira) total RNA. (breast) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189783 | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | TAX577741(Rovira) total RNA. (breast) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | TAX577743(Rovira) total RNA. (breast) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR191552(GSM715662) 42genomic small RNA (size selected RNA from t. (breast) | GSM532876(GSM532876) G547T. (cervix) | SRR040010(GSM532895) G529N. (cervix) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR189787 | SRR330882(SRX091720) tissue: skin psoriatic uninvolveddisease stat. (skin) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR040008(GSM532893) G727N. (cervix) | SRR330875(SRX091713) tissue: skin psoriatic involveddisease state:. (skin) | SRR039612(GSM531975) Human Normal Liver Tissue Sample 2. (liver) | TAX577739(Rovira) total RNA. (breast) | SRR191549(GSM715659) 105genomic small RNA (size selected RNA from . (breast) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | TAX577590(Rovira) total RNA. (breast) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577742(Rovira) total RNA. (breast) | SRR553576(SRX182782) source: Testis. (testes) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | TAX577744(Rovira) total RNA. (breast) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR207116(GSM721078) Nuclear RNA. (cell line) | TAX577453(Rovira) total RNA. (breast) | SRR040020(GSM532905) G699N_2. (cervix) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR191571(GSM715681) 63genomic small RNA (size selected RNA from t. (breast) | SRR039611(GSM531974) Human Normal Liver Tissue Sample 1. (liver) | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR189786 | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..........................................................GGGCGGCCGCGACCCCCGG............................................................................................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................................................................................................................................................................GCGTGCGCCCCGCCTGCGTAC | 21 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................................................................CGGGAAGGGCGCGCCGCCC........................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................................GTGCGTGCCGGGAAGCA..................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................CGCGGCGCCCACCCGCTG........................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................ACCCCAGGGCGGGGGACCA........................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................CGCGGCGCCCACCCGGGG........................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................................................................................GTGCCGGGAAGGGCGCTT................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................GGCGGCGGCAGGGCCGGGC................................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................CCCGCACTCACCGTGCCCTCGGACGGC............................................................................................................................................................................................. | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................GGACCCCAGGGCGGGTGG.............................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................CCCGCCCGGGTCGCG.......................................................................................................................................................................... | 15 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - |
| ...........................................................CGGGTCGCGGCCGCC................................................................................................................................................................................ | 15 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - |
| .............................................................................................................................GTCCCAGGAGGCCCTGC............................................................................................................ | 17 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - |