| (6) B-CELL | (5) BREAST | (20) CELL-LINE | (2) CERVIX | (2) HEART | (3) LIVER | (3) OTHER | (1) RRP40.ip | (10) SKIN | (1) UTERUS | (1) XRN.ip |
| TAGGGTAGACATTGATAGGAGAGACTTTCGTTCTACCAGTCTCTCCTTATTGAGGGTGGGTGTTACAGACTTTGGTAATTTATTAATACACTTGTAAAATCTTAATAGCATAAGAATAAAAATTATTAGTGATCATGTAAATACATGAAACATTTAAAAAATAATCCAACCAAATATGTTACAACTTTGTTTTTATCCAGGTTTCCAGTTTATGCAAACTTCTGTGAAAATGAGCTTTGTTATTGGTGAA .....................................................((((((((((.(((...((((((...(((((....((((.((((..(((((......))))).......)))).)))).((((((....))))))...........)))))....))))))..))).)))........))))))).................................................... ..................................................51...................................................................................................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR037937(GSM510475) 293cand2. (cell line) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR189784 | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR390723(GSM850202) total small RNA. (cell line) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | TAX577589(Rovira) total RNA. (breast) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR343334 | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | SRR037936(GSM510474) 293cand1. (cell line) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR191447(GSM715557) 142genomic small RNA (size selected RNA from . (breast) | SRR191444(GSM715554) 109genomic small RNA (size selected RNA from . (breast) | SRR033724(GSM497069) L428 cell line (L428). (B cell) | SRR060984(GSM569188) Human plasma cell [09-001]. (cell line) | GSM532881(GSM532881) G696N. (cervix) | SRR189782 | SRR015364(GSM380329) Plasma B cells (PC44). (B cell) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR033726(GSM497071) Mututated CLL (CLLM633). (B cell) | SRR038858(GSM458541) MEL202. (cell line) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR037932(GSM510470) 293cand4_rep1. (cell line) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040033(GSM532918) G603T. (cervix) | SRR191602(GSM715712) 60genomic small RNA (size selected RNA from t. (breast) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR033714(GSM497059) Burkitt Lymphoma (BL134). (B cell) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell) | TAX577743(Rovira) total RNA. (breast) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ................................................................................................................................................................................TGTTACAACTTTGTTTTTATCCAG.................................................. | 24 | 1 | 19.00 | 19.00 | 4.00 | 2.00 | - | 2.00 | - | 1.00 | - | 1.00 | - | 2.00 | - | - | - | 2.00 | - | - | - | - | 2.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................ATGTTACAACTTTGTTTTTATCCAGA................................................. | 26 | 1 | 10.00 | 6.00 | 9.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................TGTTACAACTTTGTTTTTATCCAGA................................................. | 25 | 1 | 6.00 | 19.00 | - | 2.00 | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................TGTTACAACTTTGTTTTTATCCAGGTT............................................... | 27 | 1 | 6.00 | 6.00 | - | - | 5.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................ATGTTACAACTTTGTTTTTATCCAG.................................................. | 25 | 1 | 6.00 | 6.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 2.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................TGTTACAACTTTGTTTTTATCCAGAA................................................ | 26 | 1 | 5.00 | 19.00 | - | 3.00 | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....TAGACATTGATAGGAGAGACTTT.............................................................................................................................................................................................................................. | 23 | 1 | 3.00 | 3.00 | - | - | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................ATGTTACAACTTTGTTTTTATCCAGAA................................................ | 27 | 1 | 2.00 | 6.00 | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................................................TTAAAAAATAATCCAACTCG............................................................................. | 20 | 2.00 | 0.00 | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................................................GTTACAACTTTGTTTTTATCCAG.................................................. | 23 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................TATGTTACAACTTTGTTTTTATCCAG.................................................. | 26 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................................AACTTTGTTTTTATCAACC................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | |
| .......................................................................................................................................................................................................GGTTTCCAGTTTATGCA.................................. | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................TGTTACAACTTTGTTTTT........................................................ | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................TGTTACAACTTTGTTTTTATCCATG................................................. | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..GGGTAGACATTGATAGGAGAGAC................................................................................................................................................................................................................................. | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................TGTTACAACTTTGTTTTTATC..................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................ATGTTACAACTTTGTTTTTATC..................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................ATGTTACAACTTTGTTTTTATCCAGG................................................. | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..GGGTAGACATTGATAGGAGAGACTTT.............................................................................................................................................................................................................................. | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..GGGTAGACATTGATAGGAG..................................................................................................................................................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..GGGTAGACATTGATAGGAGAGACTTTCA............................................................................................................................................................................................................................ | 28 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................................ATATGTTACAACTTTGTTTT......................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .AGGGTAGACATTGATAGGA...................................................................................................................................................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .AGGGTAGACATTGATAGGAGAGACT................................................................................................................................................................................................................................ | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................TGTTACAACTTTGTTTTTATCCAGGT................................................ | 26 | 1 | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................ATGTTACAACTTTGTTTTTATCCAT.................................................. | 25 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................GAGGGTGGGTGTTACAGACT................................................................................................................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....GTAGACATTGATAGGAGAGACTTT.............................................................................................................................................................................................................................. | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................ATTGAGGGTGGGTGTTACAGACTTCGG............................................................................................................................................................................... | 27 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............TGATAGGAGAGACTTTCG............................................................................................................................................................................................................................ | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - |
| ...GGTAGACATTGATAGGAGAGACTTTAA............................................................................................................................................................................................................................ | 27 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................TGTTACAACTTTGTTTTTATCCA................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................................................................GTGAAAATGAGCTTTGTT......... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................AAAAATAATCCAACCAACCT.......................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .AGGGTAGACATTGATAGGAGAGACTT............................................................................................................................................................................................................................... | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - |
| .......................................................................................................................................................................................................................AAACTTCTGTGAAAATGAG................ | 19 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - |
| ....GTAGACATTGATAGGAGA.................................................................................................................................................................................................................................... | 18 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - |
| TAGGGTAGACATTGATAGGAGAGACTTTCGTTCTACCAGTCTCTCCTTATTGAGGGTGGGTGTTACAGACTTTGGTAATTTATTAATACACTTGTAAAATCTTAATAGCATAAGAATAAAAATTATTAGTGATCATGTAAATACATGAAACATTTAAAAAATAATCCAACCAAATATGTTACAACTTTGTTTTTATCCAGGTTTCCAGTTTATGCAAACTTCTGTGAAAATGAGCTTTGTTATTGGTGAA .....................................................((((((((((.(((...((((((...(((((....((((.((((..(((((......))))).......)))).)))).((((((....))))))...........)))))....))))))..))).)))........))))))).................................................... ..................................................51...................................................................................................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR037937(GSM510475) 293cand2. (cell line) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR189784 | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR390723(GSM850202) total small RNA. (cell line) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | TAX577589(Rovira) total RNA. (breast) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR343334 | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | SRR037936(GSM510474) 293cand1. (cell line) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR191447(GSM715557) 142genomic small RNA (size selected RNA from . (breast) | SRR191444(GSM715554) 109genomic small RNA (size selected RNA from . (breast) | SRR033724(GSM497069) L428 cell line (L428). (B cell) | SRR060984(GSM569188) Human plasma cell [09-001]. (cell line) | GSM532881(GSM532881) G696N. (cervix) | SRR189782 | SRR015364(GSM380329) Plasma B cells (PC44). (B cell) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR033726(GSM497071) Mututated CLL (CLLM633). (B cell) | SRR038858(GSM458541) MEL202. (cell line) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR037932(GSM510470) 293cand4_rep1. (cell line) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040033(GSM532918) G603T. (cervix) | SRR191602(GSM715712) 60genomic small RNA (size selected RNA from t. (breast) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR033714(GSM497059) Burkitt Lymphoma (BL134). (B cell) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell) | TAX577743(Rovira) total RNA. (breast) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ...............................................................................................................................AGTGATCATGTAAATCCCG........................................................................................................ | 19 | 2.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................CACCCTCAATAAGGAGAGACT................................................................................................................................................................................................ | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................GACTTTCGTTCTACCGG................................................................................................................................................................................................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................AATAAGGAGAGACTGGTA....................................................................................................................................................................................................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................AATAAGGAGAGACTGGTAGA....................................................................................................................................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................AATAAGGAGAGACTGGTAGAACGAAA....................................................................................................................................................................................................... | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............GATAGGAGAGACTTTTTCA.......................................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | |
| ......................................................................................................................................................TTTGGTTGGATTATTTTTTAAATG............................................................................ | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................CATATTTGGTTGGATTATTTTT........................................................................ | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................ACCCTCAATAAGGAGAG................................................................................................................................................................................................. | 17 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - |
| ................................AAGGAGAGACTGGTAG.......................................................................................................................................................................................................... | 16 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 |