| (1) AGO1.ip OTHER.mut | (2) AGO2.ip | (1) B-CELL | (3) BRAIN | (4) BREAST | (12) CELL-LINE | (1) CERVIX | (2) HEART | (3) HELA | (4) LIVER | (2) OTHER | (1) RRP40.ip | (24) SKIN |
| AGGAGAGCCAATTCGGGACCCCCAGGGGCACTGTATGGCCACATCTCCAGGTTGGTGGTGTTCTGGTGGGGTGGGCGGGGTGCTGAAGCTGGCACAGGAGGACTGGAATTGGAGACTGGGGTGGATGGGGGCAGAAGGCTCTGGGAAAGGTGACACCACTCCTGACCCTGGTGACTCTGCCAGGTGAGCCAGGGCTGCTGGTGGCCCCGGTAAGCCAGCAGTCCCCATTCCTG ......................................................................................................((((....((((((..((((.....(((((.....))))).(((..((.....))..)))..))))..))..)))).)))).................................................. ................................................................................................97....................................................................................183................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR189782 | SRR189784 | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | GSM450609(GSM450609) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR038859(GSM458542) MM386. (cell line) | SRR029126(GSM416755) 143B. (cell line) | SRR029131(GSM416760) MCF7. (cell line) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR037935(GSM510473) 293cand3. (cell line) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191603(GSM715713) 71genomic small RNA (size selected RNA from t. (breast) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191590(GSM715700) 48genomic small RNA (size selected RNA from t. (breast) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | GSM1105753INPUT(GSM1105753) small RNA sequencing data. (hela) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330909(SRX091747) tissue: normal skindisease state: normal. (skin) | SRR040008(GSM532893) G727N. (cervix) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM1105749AGO2(GSM1105749) small RNA sequencing data. (ago2 hela) | SRR207114(GSM721076) "IP against AGO 1 & 2, RRP40 knockdown". (ago1/2 RRP40 cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR191456(GSM715566) 182genomic small RNA (size selected RNA from . (breast) | SRR037941(GSM510479) 293DroshaTN. (cell line) | DRR001483(DRX001037) "Hela long cytoplasmic cell fraction, control. (hela) | SRR444060(SRX128908) Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | GSM450600(GSM450600) miRNA sequencing raw reads from post-mortem s. (brain) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR191402(GSM715512) 43genomic small RNA (size selected RNA from t. (breast) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..................................................................................................................................................................TGACCCTGGTGACTCTGCCAGT................................................. | 22 | 1 | 23.00 | 1.00 | 9.00 | - | - | 1.00 | - | 2.00 | - | - | 1.00 | - | - | 2.00 | - | - | 1.00 | 1.00 | - | - | - | - | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................TGACCCTGGTGACTCTGCCAGA................................................. | 22 | 1 | 10.00 | 1.00 | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | 1.00 | - | - | 1.00 | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - |
| .....................................................................................................ACTGGAATTGGAGACAG................................................................................................................... | 17 | 5.00 | 0.00 | - | 5.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................ACTGGAATTGGAGACAGAA................................................................................................................. | 19 | 3.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................................................AGGTGAGCCAGGGCTGCTGGTGGC............................ | 24 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................GACCCTGGTGACTCTGCCAGT................................................. | 21 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | |
| .....................................................................................................ACTGGAATTGGAGACAGA.................................................................................................................. | 18 | 2.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................GGTGGGGTGGGCGGGGGA....................................................................................................................................................... | 18 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................ACTGGAATTGGAGACTGAAGG............................................................................................................... | 21 | 2.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | |
| ...........TTCGGGACCCCCAGGGGCACT......................................................................................................................................................................................................... | 21 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - |
| .............................................................................................................................TGGGGGCAGAAGGCTCTGG......................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................GACACCACTCCTGACGCAG............................................................... | 19 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................TGGGGTGGGCGGGGTCT...................................................................................................................................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........TTCGGGACCCCCAGGGGCACTGT....................................................................................................................................................................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................GGGCAGAAGGCTCTGGGAAAG.................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................GGGGGCAGAAGGCTCTGGGAAAGGTT................................................................................. | 26 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................CACAGGAGGACTGGAATTGGAGA...................................................................................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................GGGTGGGCGGGGTGCTGAAGCTGGCACAGGA...................................................................................................................................... | 31 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - |
| ...............................................................................................................................GGGGCAGAAGGCTCTGGGAAAGGTG................................................................................. | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................ACTGGAATTGGAGACTATC................................................................................................................. | 19 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................GTGGATGGGGGCAGAAGGCTCTGG......................................................................................... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................AGGTTGGTGGTGTTCCTA....................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........ATTCGGGACCCCCAGGGGCACT......................................................................................................................................................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................TGGGGGCAGAAGGCTCTGGGA....................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................TGAGCCAGGGCTGCTGG................................ | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................CTGGAATTGGAGACTGGGGT............................................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................GACCCTGGTGACTCTGCCAGA................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................AAGCTGGCACAGGAGGACTGGAACTGG......................................................................................................................... | 27 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................TGACCCTGGTGACTCTGCCAG.................................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - |
| ..............................................................................................................................................................................................AGGGCTGCTGGTGGCCGAC........................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | |
| ...................................................................................................................................CAGAAGGCTCTGGGAAAGGTGACACCACTCCTG..................................................................... | 33 | 1 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| AGGAGAGCCAATTCGGGACCCCCAGGGGCACTGTATGGCCACATCTCCAGGTTGGTGGTGTTCTGGTGGGGTGGGCGGGGTGCTGAAGCTGGCACAGGAGGACTGGAATTGGAGACTGGGGTGGATGGGGGCAGAAGGCTCTGGGAAAGGTGACACCACTCCTGACCCTGGTGACTCTGCCAGGTGAGCCAGGGCTGCTGGTGGCCCCGGTAAGCCAGCAGTCCCCATTCCTG ......................................................................................................((((....((((((..((((.....(((((.....))))).(((..((.....))..)))..))))..))..)))).)))).................................................. ................................................................................................97....................................................................................183................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR387910(GSM843862) antibody for ip: Ago2. (ago2 cell line) | SRR189782 | SRR189784 | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | GSM450609(GSM450609) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | SRR330863(SRX091701) tissue: skin psoriatic involveddisease state:. (skin) | SRR038859(GSM458542) MM386. (cell line) | SRR029126(GSM416755) 143B. (cell line) | SRR029131(GSM416760) MCF7. (cell line) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR330900(SRX091738) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR037935(GSM510473) 293cand3. (cell line) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191603(GSM715713) 71genomic small RNA (size selected RNA from t. (breast) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191590(GSM715700) 48genomic small RNA (size selected RNA from t. (breast) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | GSM1105753INPUT(GSM1105753) small RNA sequencing data. (hela) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR444049(SRX128897) Sample 9cDNABarcode: AF-PP-334: ACG CTC TTC C. (skin) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330909(SRX091747) tissue: normal skindisease state: normal. (skin) | SRR040008(GSM532893) G727N. (cervix) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM1105749AGO2(GSM1105749) small RNA sequencing data. (ago2 hela) | SRR207114(GSM721076) "IP against AGO 1 & 2, RRP40 knockdown". (ago1/2 RRP40 cell line) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR191456(GSM715566) 182genomic small RNA (size selected RNA from . (breast) | SRR037941(GSM510479) 293DroshaTN. (cell line) | DRR001483(DRX001037) "Hela long cytoplasmic cell fraction, control. (hela) | SRR444060(SRX128908) Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | GSM450600(GSM450600) miRNA sequencing raw reads from post-mortem s. (brain) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR191402(GSM715512) 43genomic small RNA (size selected RNA from t. (breast) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ......................................................................................................CCCATCCACCCCAGTCTCCAATTCCAG........................................................................................................ | 27 | 1 | 3.00 | 3.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..GGTCCCGAATTGGCTCTC..................................................................................................................................................................................................................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..GGGTCCCGAATTGGCTCTC.................................................................................................................................................................................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................GGGGTGGATGGGGGCCAAT................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................GTGGGCGGGGTGCTGGGCT................................................................................................................................................ | 19 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................GTGGGCGGGGTGCTGATTC................................................................................................................................................ | 19 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................CACCCCAGTCTCCAATTCCAG.............................................................................................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................................................................AATGGGGACTGCTGGC.... | 16 | 5 | 0.20 | 0.20 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 |