| (12) B-CELL | (2) BRAIN | (17) BREAST | (22) CELL-LINE | (6) CERVIX | (1) FIBROBLAST | (2) HEART | (1) HELA | (1) LIVER | (2) OTHER | (21) SKIN | (1) TESTES |
| AAAGGAGAAAATCTAGAAAACTTAGAGAAATATATAGTGATTAAATAAATAGGTAATAGTTAATGAGTATTAAAGCTCTTCTGCTTTCAGTATTAAAATATTGGATTTTTGGAAATGTTCTTAAATTGACAGAGTAAAAGAGTAATTACATGATTTTAAGGTAAATGAAAAACTTAACTTTTTTTTGATCCTTTGTATAGGTTCTCCAAGGACATAAAACTTTCCTGAATGATGCTTATAACTGGGAGTT .................................................................................................(((..(((((((((..(((........)))..))))..((((((((.............((((............))))))))))))..)))))..)))...................................................... ................................................................................................97.....................................................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR040009(GSM532894) G727T. (cervix) | SRR033715(GSM497060) Mantle Cell Lymphoma (Mino122). (B cell) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | SRR039637(GSM518474) THP1_total_sRNAs. (cell line) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR343334 | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR037937(GSM510475) 293cand2. (cell line) | SRR191594(GSM715704) 70genomic small RNA (size selected RNA from t. (breast) | SRR039635(GSM518472) THP1_nuc_sRNAs. (cell line) | DRR000559(DRX000317) "THP-1 whole cell RNA, no treatment". (cell line) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR033718(GSM497063) Multiple Myeloma (U266). (B cell) | SRR330857(SRX091695) tissue: skin psoriatic involveddisease state:. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR343332(GSM796035) "KSHV (HHV8), EBV (HHV-4)". (cell line) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR029129(GSM416758) SW480. (cell line) | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | TAX577740(Rovira) total RNA. (breast) | SRR039636(GSM518473) THP1_cyto_sRNAs. (cell line) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR343335 | TAX577579(Rovira) total RNA. (breast) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR033714(GSM497059) Burkitt Lymphoma (BL134). (B cell) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell) | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR191397(GSM715507) 30genomic small RNA (size selected RNA from t. (breast) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | SRR040011(GSM532896) G529T. (cervix) | GSM532880(GSM532880) G659T. (cervix) | SRR191612(GSM715722) 65genomic small RNA (size selected RNA from t. (breast) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191444(GSM715554) 109genomic small RNA (size selected RNA from . (breast) | GSM532874(GSM532874) G699T. (cervix) | SRR191565(GSM715675) 92genomic small RNA (size selected RNA from t. (breast) | SRR037876(GSM522374) fibroblasts_cell_culture. (fibroblast) | SRR330909(SRX091747) tissue: normal skindisease state: normal. (skin) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR037932(GSM510470) 293cand4_rep1. (cell line) | SRR191531(GSM715641) 134genomic small RNA (size selected RNA from . (breast) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191534(GSM715644) 153genomic small RNA (size selected RNA from . (breast) | SRR015448(SRR015448) cytoplasmic small RNAs. (breast) | SRR553576(SRX182782) source: Testis. (testes) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR191414(GSM715524) 31genomic small RNA (size selected RNA from t. (breast) | TAX577589(Rovira) total RNA. (breast) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR191585(GSM715695) 196genomic small RNA (size selected RNA from . (breast) | SRR191526(GSM715636) 127genomic small RNA (size selected RNA from . (breast) | SRR191445(GSM715555) 110genomic small RNA (size selected RNA from . (breast) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR191623(GSM715733) 18genomic small RNA (size selected RNA from t. (breast) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040035(GSM532920) G001T. (cervix) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR040027(GSM532912) G220T. (cervix) | SRR191479(GSM715589) 31genomic small RNA (size selected RNA from t. (breast) | SRR189777(GSM714637) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189782 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .....................................................................................................TGGATTTTTGGAAATAGGC.................................................................................................................................. | 19 | 0 | 35.00 | 9.00 | 14.00 | 6.00 | 2.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - |
| .....................................................................................................TGGATTTTTGGAAATAGTA.................................................................................................................................. | 19 | 0 | 22.00 | 9.00 | 3.00 | 4.00 | 2.00 | - | - | - | - | 3.00 | 1.00 | - | - | 1.00 | - | - | 2.00 | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................TGGATTTTTGGAAATAGT................................................................................................................................... | 18 | 0 | 16.00 | 9.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | 1.00 | - | - | 1.00 | 2.00 | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - |
| .....................................................................................................TGGATTTTTGGAAATAGGT.................................................................................................................................. | 19 | 0 | 12.00 | 9.00 | 1.00 | - | 3.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................TGGATTTTTGGAAATAGGG.................................................................................................................................. | 19 | 0 | 10.00 | 9.00 | 1.00 | 2.00 | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - |
| .....................................................................................................TGGATTTTTGGAAATAGAA.................................................................................................................................. | 19 | 0 | 10.00 | 9.00 | 4.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................TGGATTTTTGGAAAT...................................................................................................................................... | 15 | 0 | 9.00 | 9.00 | - | - | - | - | - | - | - | - | - | - | 3.00 | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | 2.00 | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................TGGATTTTTGGAAATCGGA.................................................................................................................................. | 19 | 0 | 9.00 | 9.00 | 3.00 | 1.00 | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................TGGATTTTTGGAAATCGG................................................................................................................................... | 18 | 0 | 8.00 | 9.00 | 6.00 | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................TGGATTTTTGGAAATAAG................................................................................................................................... | 18 | 0 | 7.00 | 9.00 | - | - | - | - | - | 2.00 | 2.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................TGGATTTTTGGAAATAGC................................................................................................................................... | 18 | 0 | 7.00 | 9.00 | 3.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................TGGATTTTTGGAAATGGGA.................................................................................................................................. | 19 | 7.00 | 0.00 | - | 1.00 | - | - | 1.00 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................TGGATTTTTGGAAATAGCA.................................................................................................................................. | 19 | 0 | 7.00 | 9.00 | 3.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................TGGATTTTTGGAAATACGA.................................................................................................................................. | 19 | 0 | 7.00 | 9.00 | 3.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................TGGATTTTTGGAAATAGA................................................................................................................................... | 18 | 0 | 6.00 | 9.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - |
| ......................................................................................................GGATTTTTGGAAATGGGAG................................................................................................................................. | 19 | 5.00 | 0.00 | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | 2.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................TGGATTTTTGGAAATACG................................................................................................................................... | 18 | 0 | 5.00 | 9.00 | 3.00 | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................TGGATTTTTGGAAATGAGAT................................................................................................................................. | 20 | 4.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................TGGATTTTTGGAAATGGGAG................................................................................................................................. | 20 | 4.00 | 0.00 | - | 1.00 | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................TGGATTTTTGGAAATAAGA.................................................................................................................................. | 19 | 0 | 3.00 | 9.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................TGGATTTTTGGAAATCG.................................................................................................................................... | 17 | 0 | 2.00 | 9.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - |
| ......................................................................................................GGATTTTTGGAAATGGGA.................................................................................................................................. | 18 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................TTGGATTTTTGGAAATATGT.................................................................................................................................. | 20 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................TTGGATTTTTGGAAATTGTA.................................................................................................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................................................CAAGGACATAAAACTCTG.......................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................................................................CCAAGGACATAAAACTCTG.......................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................TGGATTTTTGGAAATAGCT.................................................................................................................................. | 19 | 0 | 1.00 | 9.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................TGGATTTTTGGAAATATTA.................................................................................................................................. | 19 | 0 | 1.00 | 9.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................................................AAAACTTTCCTGAATGATGCTTATAT......... | 26 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................TTGGATTTTTGGAAATTGGA.................................................................................................................................. | 20 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................TTGGATTTTTGGAAATAGGG.................................................................................................................................. | 20 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................TTGGATTTTTGGAAATCGGT.................................................................................................................................. | 20 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................ATTGGATTTTTGGAACTAG.................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................TGGATTTTTGGAAATCGGG.................................................................................................................................. | 19 | 0 | 1.00 | 9.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................TTGGATTTTTGGAAATAGGT.................................................................................................................................. | 20 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................TGGATTTTTGGAAATAGTC.................................................................................................................................. | 19 | 0 | 1.00 | 9.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................................................................................................................AACTTTCCTGAATGATGCTT............. | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................................................................ATAAAACTTTCCTGAATGATGCTTATA.......... | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................TTTGATCCTTTGTATTCG................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................TGGATTTTTGGAAATATGG.................................................................................................................................. | 19 | 0 | 1.00 | 9.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................................ACATAAAACTTTCCTGAATGATGC............... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................TGGATTTTTGGAAATGGAA.................................................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................ATTGGATTTTTGGAAAT...................................................................................................................................... | 17 | 5 | 0.40 | 0.40 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.40 | - | - |
| ................................................................................................................................................ATTACATGATTTTAAGG......................................................................................... | 17 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - |
| AAAGGAGAAAATCTAGAAAACTTAGAGAAATATATAGTGATTAAATAAATAGGTAATAGTTAATGAGTATTAAAGCTCTTCTGCTTTCAGTATTAAAATATTGGATTTTTGGAAATGTTCTTAAATTGACAGAGTAAAAGAGTAATTACATGATTTTAAGGTAAATGAAAAACTTAACTTTTTTTTGATCCTTTGTATAGGTTCTCCAAGGACATAAAACTTTCCTGAATGATGCTTATAACTGGGAGTT .................................................................................................(((..(((((((((..(((........)))..))))..((((((((.............((((............))))))))))))..)))))..)))...................................................... ................................................................................................97.....................................................................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR040009(GSM532894) G727T. (cervix) | SRR033715(GSM497060) Mantle Cell Lymphoma (Mino122). (B cell) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | SRR039637(GSM518474) THP1_total_sRNAs. (cell line) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR343334 | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR037937(GSM510475) 293cand2. (cell line) | SRR191594(GSM715704) 70genomic small RNA (size selected RNA from t. (breast) | SRR039635(GSM518472) THP1_nuc_sRNAs. (cell line) | DRR000559(DRX000317) "THP-1 whole cell RNA, no treatment". (cell line) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR033718(GSM497063) Multiple Myeloma (U266). (B cell) | SRR330857(SRX091695) tissue: skin psoriatic involveddisease state:. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR343332(GSM796035) "KSHV (HHV8), EBV (HHV-4)". (cell line) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR029129(GSM416758) SW480. (cell line) | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | TAX577740(Rovira) total RNA. (breast) | SRR039636(GSM518473) THP1_cyto_sRNAs. (cell line) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR343335 | TAX577579(Rovira) total RNA. (breast) | SRR330894(SRX091732) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR033714(GSM497059) Burkitt Lymphoma (BL134). (B cell) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | SRR033711(GSM497056) GCB DLBCL (GCB110). (B cell) | SRR033712(GSM497057) Burkitt Lymphoma (BL510). (B cell) | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR191397(GSM715507) 30genomic small RNA (size selected RNA from t. (breast) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | SRR040011(GSM532896) G529T. (cervix) | GSM532880(GSM532880) G659T. (cervix) | SRR191612(GSM715722) 65genomic small RNA (size selected RNA from t. (breast) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191444(GSM715554) 109genomic small RNA (size selected RNA from . (breast) | GSM532874(GSM532874) G699T. (cervix) | SRR191565(GSM715675) 92genomic small RNA (size selected RNA from t. (breast) | SRR037876(GSM522374) fibroblasts_cell_culture. (fibroblast) | SRR330909(SRX091747) tissue: normal skindisease state: normal. (skin) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR037932(GSM510470) 293cand4_rep1. (cell line) | SRR191531(GSM715641) 134genomic small RNA (size selected RNA from . (breast) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191534(GSM715644) 153genomic small RNA (size selected RNA from . (breast) | SRR015448(SRR015448) cytoplasmic small RNAs. (breast) | SRR553576(SRX182782) source: Testis. (testes) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR191414(GSM715524) 31genomic small RNA (size selected RNA from t. (breast) | TAX577589(Rovira) total RNA. (breast) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | SRR191585(GSM715695) 196genomic small RNA (size selected RNA from . (breast) | SRR191526(GSM715636) 127genomic small RNA (size selected RNA from . (breast) | SRR191445(GSM715555) 110genomic small RNA (size selected RNA from . (breast) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR191623(GSM715733) 18genomic small RNA (size selected RNA from t. (breast) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040035(GSM532920) G001T. (cervix) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | SRR040027(GSM532912) G220T. (cervix) | SRR191479(GSM715589) 31genomic small RNA (size selected RNA from t. (breast) | SRR189777(GSM714637) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189782 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ............................................................................................................................................................TAAGGTAAATGAAAACC............................................................................. | 17 | 6.00 | 0.00 | - | - | - | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................TGACAGAGTAAAAGACCTG......................................................................................................... | 19 | 5.00 | 0.00 | - | - | - | - | - | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................AAACTTAGAGAAATAGCT....................................................................................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................AAATAAATAGGTAATTTTG............................................................................................................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | |
| ....................................................................................................................................TAATTACTCTTTTACT...................................................................................................... | 16 | 6 | 0.17 | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.17 |