| (1) AGO2.ip | (9) B-CELL | (3) BRAIN | (18) BREAST | (27) CELL-LINE | (1) FIBROBLAST | (2) HEART | (2) HELA | (4) LIVER | (1) OTHER | (17) SKIN | (1) TESTES | (2) UTERUS | (1) XRN.ip |
| CTCTGGTGTCTGCTCTTACAAGAACACTGATCCTGTCATGAGGGCTCCATCCTCATGACCTCATAACCCTAATTACCTCCAGAAGCCTCATCTCCTAATACCATCACATGGGAGGTTACAGCTTCAACATATGAATTTGGTGGGGGTGCAGCTCAGTCCACAGCAGGTAGTAATGTGCATTTTAAAACTTGTTTATACAGTACAAGAAGTTACTTACTGAAGAAGGACAAAAAATAGGAACATTTGAGAG ...........................................................................................................................................(((((((.....)))...)))).((((((..(((........)))..)))))).......................................................... ........................................................................................................................................137............................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR037939(GSM510477) 293cand5_rep1. (cell line) | SRR189787 | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR189784 | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR037940(GSM510478) 293cand5_rep2. (cell line) | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR189782 | SRR189785 | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR037876(GSM522374) fibroblasts_cell_culture. (fibroblast) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR553576(SRX182782) source: Testis. (testes) | SRR189778(GSM714638) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | TAX577745(Rovira) total RNA. (breast) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR191420(GSM715530) 122genomic small RNA (size selected RNA from . (breast) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | TAX577590(Rovira) total RNA. (breast) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR189786 | SRR191602(GSM715712) 60genomic small RNA (size selected RNA from t. (breast) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | TAX577453(Rovira) total RNA. (breast) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | GSM450597(GSM450597) miRNA sequencing raw reads from post-mortem s. (brain) | SRR038852(GSM458535) QF1160MB. (cell line) | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | TAX577740(Rovira) total RNA. (breast) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR015360(GSM380325) Plasma B cells (PC137). (B cell) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | TAX577580(Rovira) total RNA. (breast) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR343333(GSM796036) KSHV (HHV8). (cell line) | SRR037937(GSM510475) 293cand2. (cell line) | TAX577741(Rovira) total RNA. (breast) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577579(Rovira) total RNA. (breast) | SRR015361(GSM380326) Memory B cells (MM55). (B cell) | SRR189777(GSM714637) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR015359(GSM380324) Germinal Center B cell (GC136). (B cell) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191613(GSM715723) 66genomic small RNA (size selected RNA from t. (breast) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR191599(GSM715709) 89genomic small RNA (size selected RNA from t. (breast) | SRR343332(GSM796035) "KSHV (HHV8), EBV (HHV-4)". (cell line) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR189783 | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450609(GSM450609) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver) | SRR038855(GSM458538) D10. (cell line) | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell) | SRR033726(GSM497071) Mututated CLL (CLLM633). (B cell) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | TAX577739(Rovira) total RNA. (breast) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR191594(GSM715704) 70genomic small RNA (size selected RNA from t. (breast) | SRR037938(GSM510476) 293Red. (cell line) | SRR037941(GSM510479) 293DroshaTN. (cell line) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR444060(SRX128908) Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR029132(GSM416761) MB-MDA231. (cell line) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | SRR191393(GSM715503) 22genomic small RNA (size selected RNA from t. (breast) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | TAX577738(Rovira) total RNA. (breast) | SRR060986(GSM569190) Human memory B cell [09-001]. (cell line) | SRR038856(GSM458539) D11. (cell line) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR343337 | SRR191550(GSM715660) 27genomic small RNA (size selected RNA from t. (breast) | TAX577743(Rovira) total RNA. (breast) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .............................................................................................................................................GGGGGTGCAGCTCAGTGG........................................................................................... | 18 | 4 | 27.75 | 0.50 | - | 2.50 | 5.00 | 2.25 | 0.25 | 0.25 | 1.25 | 0.25 | 0.25 | 0.50 | - | 0.25 | 1.50 | - | - | - | 0.25 | - | - | - | - | 1.00 | - | - | - | 0.75 | - | - | - | 0.75 | - | - | 0.25 | 0.50 | 0.25 | - | 0.50 | 0.25 | 0.50 | 0.25 | 0.25 | - | - | 0.25 | 0.50 | 0.50 | 0.25 | 0.25 | 0.25 | - | - | 0.25 | - | - | - | 0.25 | - | 0.25 | - | 0.25 | - | - | 0.25 | 0.25 | 0.25 | 0.25 | - | 0.25 | - | 0.25 | - | - | 0.25 | - | 0.25 | - | 0.25 | - | 0.25 | - | 0.25 | 0.25 | 0.25 | 0.25 | 0.25 | 0.25 | - | 0.25 | - | 0.25 | - | - | 0.25 | 0.25 |
| ............................................................................................................................................................................................................................AGAAGGACAAAAAATAGGATTT........ | 22 | 11.00 | 0.00 | 8.00 | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................GGGGGTGCAGCTCAGTGGT.......................................................................................... | 19 | 4 | 8.25 | 0.50 | - | 0.50 | - | - | 0.25 | - | - | - | 0.25 | 0.50 | - | - | - | 0.25 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | 0.25 | - | - | - | 0.25 | - | 0.25 | 0.25 | - | 0.50 | 0.50 | 0.25 | - | - | - | 0.25 | 0.25 | - | - | - | 0.25 | - | 0.25 | - | 0.25 | - | - | - | 0.25 | 0.25 | - | - | - | - | 0.25 | - | 0.25 | - | 0.25 | 0.25 | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | 0.25 | - | - | - |
| .............................................................................................................................................GGGGGTGCAGCTCAGTGGTA......................................................................................... | 20 | 4 | 5.75 | 0.50 | - | 0.50 | - | 0.25 | 0.25 | - | - | - | 0.25 | 0.75 | - | - | - | 0.25 | - | - | - | 0.25 | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | 0.25 | - | 0.50 | - | - | 0.50 | - | - | 0.25 | - | - | - | - | - | 0.25 | - | - | 0.50 | - | - | - | 0.25 | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................................................ACTGAAGAAGGACAAAAAATAGG............ | 23 | 1 | 3.00 | 3.00 | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................GGGGGTGCAGCTCAGAGG........................................................................................... | 18 | 3.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................TGGGGGTGCAGCTCAGTGG........................................................................................... | 19 | 2.00 | 0.00 | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................................................................................GTTACTTACTGAAGAAGGACAAAAAA................ | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................CAGCAGGTAGTAATGTTTTG...................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................................................................TACTGAAGAAGGACAAAAAATAGGAACAA....... | 29 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................................................................................................CTGAAGAAGGACAAAAAATAGGAACATT...... | 28 | 1 | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................................................................TACTGAAGAAGGACAAAAAATAG............. | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................................................ACTGAAGAAGGACAAAAAATAG............. | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................................................AGTACAAGAAGTTACTTACT................................ | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................GGGGGTGCAGCTCAGAGA........................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................................................................CAAGAAGTTACTTACTGAAGAAGGAC...................... | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................ATTTTAAAACTTGTTTACCA.................................................... | 20 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................GGGGGTGCAGCTCAGAG............................................................................................ | 17 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................................................ACTGAAGAAGGACAAAAAATT.............. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................................................................AAGGACAAAAAATAGGAACATTTGAGAG | 28 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................GGGGGTGCAGCTCAGTCGGA......................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................GGGGGTGCAGCTCAGATGG.......................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................GGGGGTGCAGCTCAGTCCGGGG....................................................................................... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................................................................GAAGTTACTTACTGAAGAAGGAC...................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................................................................................................................TGAAGAAGGACAAAAAATAGGAACATTTGAGA. | 32 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................................................AAGAAGTTACTTACTGAAGA........................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................................................................GAAGAAGGACAAAAAATAG............. | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................GGGGGTGCAGCTCAGTCT........................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................GGGGGTGCAGCTCAGAGGT.......................................................................................... | 19 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................GGGGGTGCAGCTCAGAGC........................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................GGGGGTGCAGCTCAGTTGGG......................................................................................... | 20 | 4 | 0.75 | 0.50 | - | - | - | - | - | - | - | - | - | - | 0.75 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................GGGGGTGCAGCTCAGTGGG.......................................................................................... | 19 | 4 | 0.75 | 0.50 | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................GGGGGTGCAGCTCAGT............................................................................................. | 16 | 4 | 0.50 | 0.50 | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - |
| ..........................................................................................................................................................................................................................................TAGGAACATTTGAGAG | 16 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................GGGGGTGCAGCTCAGTGT........................................................................................... | 18 | 4 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................CTCATAACCCTAATT................................................................................................................................................................................ | 15 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................GGGGGTGCAGCTCAGTGGAA......................................................................................... | 20 | 4 | 0.25 | 0.50 | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................................................................AAGGACAAAAAATAGG............ | 16 | 8 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - |
| .............................................................................................................................................GGGGGTGCAGCTCAGTTGT.......................................................................................... | 19 | 4 | 0.25 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................GGGGGTGCAGCTCAGTAGC.......................................................................................... | 19 | 4 | 0.25 | 0.50 | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................GGGGGTGCAGCTCAGTGGAG......................................................................................... | 20 | 4 | 0.25 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................GGGGGTGCAGCTCAGTGGC.......................................................................................... | 19 | 4 | 0.25 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................GGGGGTGCAGCTCAGTGC........................................................................................... | 18 | 4 | 0.25 | 0.50 | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................GGGGGTGCAGCTCAGTTGG.......................................................................................... | 19 | 4 | 0.25 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................CATCTCCTAATACCATCACATGG........................................................................................................................................... | 23 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| CTCTGGTGTCTGCTCTTACAAGAACACTGATCCTGTCATGAGGGCTCCATCCTCATGACCTCATAACCCTAATTACCTCCAGAAGCCTCATCTCCTAATACCATCACATGGGAGGTTACAGCTTCAACATATGAATTTGGTGGGGGTGCAGCTCAGTCCACAGCAGGTAGTAATGTGCATTTTAAAACTTGTTTATACAGTACAAGAAGTTACTTACTGAAGAAGGACAAAAAATAGGAACATTTGAGAG ...........................................................................................................................................(((((((.....)))...)))).((((((..(((........)))..)))))).......................................................... ........................................................................................................................................137............................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR037939(GSM510477) 293cand5_rep1. (cell line) | SRR189787 | SRR207110(GSM721072) Nuclear RNA. (cell line) | SRR189784 | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR037940(GSM510478) 293cand5_rep2. (cell line) | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | SRR326281(GSM769511) "Dicer mRNA was knocked down using siDicer, c. (cell line) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR189782 | SRR189785 | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR037876(GSM522374) fibroblasts_cell_culture. (fibroblast) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR553576(SRX182782) source: Testis. (testes) | SRR189778(GSM714638) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | TAX577745(Rovira) total RNA. (breast) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR191420(GSM715530) 122genomic small RNA (size selected RNA from . (breast) | SRR039620(GSM531983) HBV(+) Adjacent Tissue Sample 2. (liver) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | TAX577590(Rovira) total RNA. (breast) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR189786 | SRR191602(GSM715712) 60genomic small RNA (size selected RNA from t. (breast) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | TAX577453(Rovira) total RNA. (breast) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | GSM450597(GSM450597) miRNA sequencing raw reads from post-mortem s. (brain) | SRR038852(GSM458535) QF1160MB. (cell line) | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | TAX577740(Rovira) total RNA. (breast) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | SRR015360(GSM380325) Plasma B cells (PC137). (B cell) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | TAX577580(Rovira) total RNA. (breast) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR343333(GSM796036) KSHV (HHV8). (cell line) | SRR037937(GSM510475) 293cand2. (cell line) | TAX577741(Rovira) total RNA. (breast) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577579(Rovira) total RNA. (breast) | SRR015361(GSM380326) Memory B cells (MM55). (B cell) | SRR189777(GSM714637) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR015359(GSM380324) Germinal Center B cell (GC136). (B cell) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191613(GSM715723) 66genomic small RNA (size selected RNA from t. (breast) | SRR094130(GSM651906) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR191599(GSM715709) 89genomic small RNA (size selected RNA from t. (breast) | SRR343332(GSM796035) "KSHV (HHV8), EBV (HHV-4)". (cell line) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR189783 | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330885(SRX091723) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450609(GSM450609) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver) | SRR038855(GSM458538) D10. (cell line) | SRR033725(GSM497070) Unmutated CLL (CLLU626). (B cell) | SRR033726(GSM497071) Mututated CLL (CLLM633). (B cell) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | TAX577739(Rovira) total RNA. (breast) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR191594(GSM715704) 70genomic small RNA (size selected RNA from t. (breast) | SRR037938(GSM510476) 293Red. (cell line) | SRR037941(GSM510479) 293DroshaTN. (cell line) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR444060(SRX128908) Sample 18cDNABarcode: AF-PP-340: ACG CTC TTC . (skin) | SRR029132(GSM416761) MB-MDA231. (cell line) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | SRR191393(GSM715503) 22genomic small RNA (size selected RNA from t. (breast) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | TAX577738(Rovira) total RNA. (breast) | SRR060986(GSM569190) Human memory B cell [09-001]. (cell line) | SRR038856(GSM458539) D11. (cell line) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR343337 | SRR191550(GSM715660) 27genomic small RNA (size selected RNA from t. (breast) | TAX577743(Rovira) total RNA. (breast) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..........................................................................................................................................................................................................................GAAGAAGGACAAAAAATAT............. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................................................................AGTAATGTGCATTTTAAATATG............................................................ | 22 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |