| (1) AGO2.ip | (3) B-CELL | (2) BRAIN | (6) BREAST | (12) CELL-LINE | (2) CERVIX | (1) FIBROBLAST | (8) HEART | (2) HELA | (2) LIVER | (2) OTHER | (17) SKIN |
| AGGCACATGCCATCATGCCCAGCTAATTCAGATAATTTTTTGTAGAGACAAGATTTCACCATGTTTCCCTGCCTGGTCTCTAACTCCTGAACTCAAGCAATTCACCTATCTTGGCCTCCCAAAATGCTGAGATTACAGGTGTGAGCCACCACACCTGGCCTAAACCTGGATCTTAATAAATACCATATTGTTCTTTCCAGAAAGAGACAAGCAGTGCCCTGACCCATGCTGGAGCCCATCTTGACCTCTC .........................................................................(((.(((..((.(((((((((.((((...........((((....))))..))))))).)).)))).))))))))...................................................................................................... ...................................................................68..................................................................................152................................................................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR189784 | SRR029124(GSM416753) HeLa. (hela) | TAX577580(Rovira) total RNA. (breast) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189782 | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | GSM532876(GSM532876) G547T. (cervix) | TAX577588(Rovira) total RNA. (breast) | TAX577746(Rovira) total RNA. (breast) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033710(GSM497055) GCB DLBCL (GCB385). (B cell) | GSM1105753INPUT(GSM1105753) small RNA sequencing data. (hela) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR040008(GSM532893) G727N. (cervix) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | TAX577739(Rovira) total RNA. (breast) | TAX577590(Rovira) total RNA. (breast) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039635(GSM518472) THP1_nuc_sRNAs. (cell line) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR343335 | SRR060168(GSM565978) 5-8F_nucleus. (cell line) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR363673(GSM830250) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR029125(GSM416754) U2OS. (cell line) | SRR189786 | SRR330857(SRX091695) tissue: skin psoriatic involveddisease state:. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ........................................................................CTGGTCTCTAACTCCTGAACTCTG.......................................................................................................................................................... | 24 | 27.00 | 0.00 | - | 8.00 | 4.00 | 1.00 | - | - | - | - | - | - | - | - | 2.00 | - | - | 1.00 | - | 2.00 | - | - | 1.00 | - | 2.00 | - | - | - | - | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................TCTAACTCCTGAACTCTG.......................................................................................................................................................... | 18 | 13.00 | 0.00 | - | - | 2.00 | 3.00 | 1.00 | - | - | - | 3.00 | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | |
| ..............................................................................................................................CTGAGATTACAGGTGTGAGGGG...................................................................................................... | 22 | 10.00 | 0.00 | 10.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................GTCTCTAACTCCTGAACTCTG.......................................................................................................................................................... | 21 | 5.00 | 0.00 | - | - | 1.00 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................TCTCTAACTCCTGAACTCTG.......................................................................................................................................................... | 20 | 4.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................CTCTAACTCCTGAACTCTG.......................................................................................................................................................... | 19 | 4.00 | 0.00 | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | |
| ..................................................................................................................CCTCCCAAAATGCTGAGGGGG................................................................................................................... | 21 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................TGGTCTCTAACTCCTGAACTCTG.......................................................................................................................................................... | 23 | 2.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | |
| ................................................................................................................................................................................................................AAGCAGTGCCCTGACCCATGCTGG.................. | 24 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................AATGCTGAGATTACAGGTGTGAGCCACCGCT................................................................................................. | 31 | 2.00 | 0.00 | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................................................GCCCTGACCCATGCTGGAGC............... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - |
| .....................................................................................CCTGAACTCAAGCAAAACC.................................................................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | |
| .........................................................................................................................................................................................................AAGAGACAAGCAGTGCCCTGAC........................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................CAAAATGCTGAGATTACAGTCCT............................................................................................................ | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | |
| ........................................................................................................................................................................................................AAAGAGACAAGCAGTGCCCTGACCCATGC..................... | 29 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................................................GAGACAAGCAGTGCCCTGACC.......................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................CAAAATGCTGAGATTCCAC................................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................GGTCTCTAACTCCTGAACTCAAGCAATTCAC................................................................................................................................................. | 31 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................CCTGAACTCAAGCAAGATT.................................................................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................................................GCAGTGCCCTGACCCATGCTGGAG................ | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................................................................AGACAAGCAGTGCCCTGA............................ | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................TTTTTTGTAGAGACAAG...................................................................................................................................................................................................... | 17 | 0 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................TTACAGGTGTGAGCCACCACACCTGGCGGAC....................................................................................... | 31 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................TTTCCCTGCCTGGTCCTTG........................................................................................................................................................................ | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................GGTCTCTAACTCCTGAACTCTG.......................................................................................................................................................... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................................................................AGAGACAAGCAGTGCCCTGAC........................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................................................AGAGACAAGCAGTGCCCTGACCCACG...................... | 26 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................GGTCTCTAACTCCTGAACTCCG.......................................................................................................................................................... | 22 | 1.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................TCTAACTCCTGAACTCAAGCAATTCACCT............................................................................................................................................... | 29 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................................................AAGCAGTGCCCTGACCCATGCTGGAGCCCATC.......... | 32 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................................................GAGACAAGCAGTGCCCTGACCCATGCT.................... | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................................................................CCCTGACCCATGCTGGAGC............... | 19 | 1 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................................................................ATGCTGGAGCCCATCTTGACCTCTC | 25 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - |
| ...............................................................................................................................................................................................................CAAGCAGTGCCCTGA............................ | 15 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 |
| AGGCACATGCCATCATGCCCAGCTAATTCAGATAATTTTTTGTAGAGACAAGATTTCACCATGTTTCCCTGCCTGGTCTCTAACTCCTGAACTCAAGCAATTCACCTATCTTGGCCTCCCAAAATGCTGAGATTACAGGTGTGAGCCACCACACCTGGCCTAAACCTGGATCTTAATAAATACCATATTGTTCTTTCCAGAAAGAGACAAGCAGTGCCCTGACCCATGCTGGAGCCCATCTTGACCTCTC .........................................................................(((.(((..((.(((((((((.((((...........((((....))))..))))))).)).)))).))))))))...................................................................................................... ...................................................................68..................................................................................152................................................................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR189780(GSM714640) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR189784 | SRR029124(GSM416753) HeLa. (hela) | TAX577580(Rovira) total RNA. (breast) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189782 | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR330873(SRX091711) tissue: skin psoriatic involveddisease state:. (skin) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | GSM532876(GSM532876) G547T. (cervix) | TAX577588(Rovira) total RNA. (breast) | TAX577746(Rovira) total RNA. (breast) | SRR330888(SRX091726) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033710(GSM497055) GCB DLBCL (GCB385). (B cell) | GSM1105753INPUT(GSM1105753) small RNA sequencing data. (hela) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR039192(GSM494811) K562 cell line is derived from a CML patient . (cell line) | SRR040008(GSM532893) G727N. (cervix) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | TAX577739(Rovira) total RNA. (breast) | TAX577590(Rovira) total RNA. (breast) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039635(GSM518472) THP1_nuc_sRNAs. (cell line) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR343335 | SRR060168(GSM565978) 5-8F_nucleus. (cell line) | GSM450602(GSM450602) miRNA sequencing raw reads from post-mortem s. (brain) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR363673(GSM830250) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR330866(SRX091704) tissue: skin psoriatic involveddisease state:. (skin) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR029125(GSM416754) U2OS. (cell line) | SRR189786 | SRR330857(SRX091695) tissue: skin psoriatic involveddisease state:. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..................................................................................................................................................CACCACACCTGGCCTAACAA.................................................................................... | 20 | 4.00 | 0.00 | - | - | - | - | - | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................................................................AGACAAGCAGTGCCCTGATTGT........................ | 22 | 1 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................................................................AGACAAGCAGTGCCCTGATTTT........................ | 22 | 1 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - |
| .........................ATTCAGATAATTTTTGTAG.............................................................................................................................................................................................................. | 19 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................CATGTTTCCCTGCCTGAAGC........................................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................................................................................CAAGCAGTGCCCTGACAT......................... | 18 | 7 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................GTGAGCCACCACACCTGGCCTACTTG.................................................................................... | 26 | 1.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................CTCAGCATTTTGGGAG....................................................................................................................... | 16 | 0 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................GCCACCACACCTGGCCTAACT..................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................TCCAGGTTTAGGCCAGGTGTGGTGG................................................................................ | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................................................................TCAGGGCACTGCTTGTC............................ | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................................................................................ACAAGCAGTGCCCTGAATAG........................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................GCCACCACACCTGGCCTAAC...................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................CCTGTAATCTCAGCATTTTGGGAGGC............................................................................................................... | 26 | 0 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................................................................AGACAAGCAGTGCCCTGATGG......................... | 21 | 1 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................GCCACCACACCTGGCCGGT....................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................................................................AGACAAGCAGTGCCCTGATGTT........................ | 22 | 1 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................................................................AGACAAGCAGTGCCCTGAAT.......................... | 20 | 1 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........CCATCATGCCCAGCTAATTGGTG.......................................................................................................................................................................................................................... | 23 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - |