| (1) AGO1.ip | (2) AGO2.ip | (3) B-CELL | (2) BRAIN | (5) BREAST | (18) CELL-LINE | (4) CERVIX | (1) HEART | (2) HELA | (2) LIVER | (2) OTHER | (19) SKIN | (1) XRN.ip |
| CAGCGGGAGCGCGAGGAGCAGGAGCGGAGGCTGCAGGCAGAAAGGGACAAGTGAGTGCGCCTCGGGGACTGAGGGGGCCCTCGTGGGCGCTGGAGAAGAAGCAGAGGCCGAGCCTGAGCCGTTTGCTCCGTCCCCCAGGCGAATGCGAGAGGAGCAGCTGGCACGGGAGGCCGAGGCCCGGGCGGAGC ........................................................(((((((((((.((.....)).))))).)))))).................................................................................................. ..................................................51....................................................105................................................................................. | Size | Perfect hit | Total Norm | Perfect Norm | SRR444068(SRX128916) Sample 25cDNABarcode: AF-PP-341: ACG CTC TTC . (cell line) | SRR444055(SRX128903) Sample 27_2cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR444070(SRX128918) Sample 27_4cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR444047(SRX128895) Sample 27_1cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR444062(SRX128910) Sample 27_3cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR444067(SRX128915) Sample 24cDNABarcode: AF-PP-340: ACG CTC TTC . (cell line) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR189785 | SRR444066(SRX128914) Sample 23cDNABarcode: AF-PP-339: ACG CTC TTC . (cell line) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR040018(GSM532903) G701N. (cervix) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR040008(GSM532893) G727N. (cervix) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | SRR444065(SRX128913) Sample 22cDNABarcode: AF-PP-335: ACG CTC TTC . (cell line) | SRR060168(GSM565978) 5-8F_nucleus. (cell line) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191412(GSM715522) 24genomic small RNA (size selected RNA from t. (breast) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR330857(SRX091695) tissue: skin psoriatic involveddisease state:. (skin) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR040011(GSM532896) G529T. (cervix) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR191549(GSM715659) 105genomic small RNA (size selected RNA from . (breast) | SRR015447(SRR015447) nuclear small RNAs. (breast) | SRR033715(GSM497060) Mantle Cell Lymphoma (Mino122). (B cell) | GSM956925Ago2D5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR189786 | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444053(SRX128901) Sample 13cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | GSM956925Ago2PAZ(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR189778(GSM714638) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040010(GSM532895) G529N. (cervix) | TAX577741(Rovira) total RNA. (breast) | GSM450610(GSM450610) miRNA sequencing raw reads from post-mortem s. (brain) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | DRR000560(DRX000318) Isolation of RNA following immunoprecipitatio. (ago1 cell line) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR191550(GSM715660) 27genomic small RNA (size selected RNA from t. (breast) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .................................................................................CGTGGGCGCTGGAGAA........................................................................................... | 16 | 1 | 150.00 | 150.00 | 74.00 | 18.00 | 25.00 | 12.00 | 10.00 | 6.00 | - | - | 4.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................GTGGGCGCTGGAGAA........................................................................................... | 15 | 4 | 17.50 | 17.50 | 4.50 | 4.25 | - | 4.25 | 3.00 | 0.25 | - | - | 0.50 | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - |
| .................................................................................CGTGGGCGCTGGAGA............................................................................................ | 15 | 3 | 6.00 | 6.00 | - | - | - | - | - | - | 5.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | 0.33 | - | - | - | - |
| .................................................................................CGTGGGCGCTGGAGAACTGA....................................................................................... | 20 | 1 | 6.00 | 150.00 | - | - | - | - | - | - | - | 2.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................CGTGGGCGCTGGAGAACTG........................................................................................ | 19 | 1 | 4.00 | 150.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................GTGGGCGCTGGAGAACTGG....................................................................................... | 19 | 4 | 2.75 | 17.50 | - | 1.00 | - | 1.00 | 0.75 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................AGCAGGAGCGGAGGCTGCAG........................................................................................................................................................ | 20 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................CGTGGGCGCTGGAGAAC.......................................................................................... | 17 | 1 | 2.00 | 150.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................CGTGGGCGCTGGAGAACTGG....................................................................................... | 20 | 1 | 2.00 | 150.00 | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................CGTGGGCGCTGGAGAACT......................................................................................... | 18 | 1 | 2.00 | 150.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........CGAGGAGCAGGAGCGGAGG.............................................................................................................................................................. | 19 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................GTGGGCGCTGGAGAACTGA....................................................................................... | 19 | 4 | 1.25 | 17.50 | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | 0.25 | 0.25 | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - |
| ....................................................................................................GCAGAGGCCGAGCCTGGCC..................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................GAGGCTGCAGGCAGAATG................................................................................................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................AGCGGAGGCTGCAGGGGG.................................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........CGAGGAGCAGGAGCGGAGGCTGCAG........................................................................................................................................................ | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................GCAGGAGCGGAGGCTGCAGGAA..................................................................................................................................................... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................ACGGGAGGCCGAGGCCGGA....... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................AGTGCGCCTCGGGGACATGG................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................AGCGGAGGCTGCAGGCAGAAA................................................................................................................................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................GCGGAGGCTGCAGGCAGA................................................................................................................................................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................GCGCTGGAGAAGAAGCCG.................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................AGGCCGAGCCTGAGCCGTTTG............................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................CGCTGGAGAAGAAGCAGAGGCCGAGCCTGA....................................................................... | 30 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - |
| ...CGGGAGCGCGAGGAGCAGA...................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................CAGCTGGCACGGGAGGCCGAGGCCCGG....... | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................GGGAGGCCGAGGCCCGGGCGGAGC | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........GCGAGGAGCAGGAGCGGAGGCTG........................................................................................................................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............AGGAGCAGGAGCGGAGGCTGCAGGCAG.................................................................................................................................................... | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................GGAGGCTGCAGGCAGAAAGGGACA........................................................................................................................................... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................GGGGACTGAGGGGGCCATTA......................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................................................................AGGAGCAGCTGGCACGGGAGG.................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................GCACGGGAGGCCGAGGGGC......... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | |
| .........................................................................................CTGGAGAAGAAGCAGAGGC................................................................................ | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................CTCGTGGGCGCTGGAGAAGAAGCA..................................................................................... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................GCAGGCAGAAAGGGACCA.......................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................GCGCTGGAGAAGAAGCAGAG.................................................................................. | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................CGTGGGCGCTGGAGAACTTA....................................................................................... | 20 | 1 | 1.00 | 150.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................AGCAGGAGCGGAGGCTGCAGGCTC.................................................................................................................................................... | 24 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................CAGGAGCGGAGGCTGCAGGCAGAAAG................................................................................................................................................ | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............AGGAGCAGGAGCGGAGG.............................................................................................................................................................. | 17 | 2 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................ATGCGAGAGGAGCAGCTGGCACGGG..................... | 25 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................GTGAGTGCGCCTCGGGGACTGA.................................................................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................GAGGCCGAGGCCCGGGCGG... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............AGGAGCAGGAGCGGAGGCTGCAG........................................................................................................................................................ | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - |
| ....GGGAGCGCGAGGAGCAGGAGCGGAGG.............................................................................................................................................................. | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................CAGGAGCGGAGGCTGCAGGC...................................................................................................................................................... | 20 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ............GAGGAGCAGGAGCGGAGG.............................................................................................................................................................. | 18 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - |
| ...........................AGGCTGCAGGCAGAAAGGG.............................................................................................................................................. | 19 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................CGAGGCCCGGGCGGA.. | 15 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................GTGGGCGCTGGAGAAC.......................................................................................... | 16 | 4 | 0.50 | 17.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - |
| ....................GGAGCGGAGGCTGCAGGCA..................................................................................................................................................... | 19 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................AGGAGCGGAGGCTGCAGG....................................................................................................................................................... | 18 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - |
| .....................GAGCGGAGGCTGCAGGCA..................................................................................................................................................... | 18 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - |
| ......................AGCGGAGGCTGCAGGCAG.................................................................................................................................................... | 18 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................CAGGCAGAAAGGGACAA.......................................................................................................................................... | 17 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................GTGGGCGCTGGAGAACTG........................................................................................ | 18 | 4 | 0.25 | 17.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 |
| CAGCGGGAGCGCGAGGAGCAGGAGCGGAGGCTGCAGGCAGAAAGGGACAAGTGAGTGCGCCTCGGGGACTGAGGGGGCCCTCGTGGGCGCTGGAGAAGAAGCAGAGGCCGAGCCTGAGCCGTTTGCTCCGTCCCCCAGGCGAATGCGAGAGGAGCAGCTGGCACGGGAGGCCGAGGCCCGGGCGGAGC ........................................................(((((((((((.((.....)).))))).)))))).................................................................................................. ..................................................51....................................................105................................................................................. | Size | Perfect hit | Total Norm | Perfect Norm | SRR444068(SRX128916) Sample 25cDNABarcode: AF-PP-341: ACG CTC TTC . (cell line) | SRR444055(SRX128903) Sample 27_2cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR444070(SRX128918) Sample 27_4cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR444047(SRX128895) Sample 27_1cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR444062(SRX128910) Sample 27_3cDNABarcode: AF-PP-343: ACG CTC TT. (skin) | SRR444067(SRX128915) Sample 24cDNABarcode: AF-PP-340: ACG CTC TTC . (cell line) | SRR387909(GSM843861) specific-host: Homo sapienshost cell line: Su. (cell line) | SRR189785 | SRR444066(SRX128914) Sample 23cDNABarcode: AF-PP-339: ACG CTC TTC . (cell line) | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR040018(GSM532903) G701N. (cervix) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR040008(GSM532893) G727N. (cervix) | SRR039190(GSM494809) PBMCs were isolated by ficoll gradient from t. (blood) | SRR444065(SRX128913) Sample 22cDNABarcode: AF-PP-335: ACG CTC TTC . (cell line) | SRR060168(GSM565978) 5-8F_nucleus. (cell line) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR330892(SRX091730) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191412(GSM715522) 24genomic small RNA (size selected RNA from t. (breast) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR330857(SRX091695) tissue: skin psoriatic involveddisease state:. (skin) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR040011(GSM532896) G529T. (cervix) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR191549(GSM715659) 105genomic small RNA (size selected RNA from . (breast) | SRR015447(SRR015447) nuclear small RNAs. (breast) | SRR033715(GSM497060) Mantle Cell Lymphoma (Mino122). (B cell) | GSM956925Ago2D5(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR189786 | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR444053(SRX128901) Sample 13cDNABarcode: AF-PP-341: ACG CTC TTC . (skin) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | GSM956925Ago2PAZ(GSM956925) "cell line: HEK293 cell linepassages: 15-20ip. (ago2 cell line) | GSM450605(GSM450605) miRNA sequencing raw reads from post-mortem s. (brain) | SRR189778(GSM714638) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040010(GSM532895) G529N. (cervix) | TAX577741(Rovira) total RNA. (breast) | GSM450610(GSM450610) miRNA sequencing raw reads from post-mortem s. (brain) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | DRR000560(DRX000318) Isolation of RNA following immunoprecipitatio. (ago1 cell line) | DRR001488(DRX001042) "Hela short nuclear cell fraction, LNA(+)". (hela) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR191550(GSM715660) 27genomic small RNA (size selected RNA from t. (breast) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .......................................................................................................................................................................AGGCCGAGGCCCGGGGCCT.. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................AGCAGAGGCCGAGCCGGGC...................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |