| (3) B-CELL | (4) BRAIN | (16) BREAST | (14) CERVIX | (1) FIBROBLAST | (6) HEART | (1) KIDNEY | (4) LIVER | (3) OTHER | (24) SKIN | (1) TESTES | (1) UTERUS |
| TCTGGAGGCTTTGAAGTCAACAAGAATAATTCCTTCCATATCAACATGAGGTAAGTTTGAGACTCTAAATATAGACAAAAAGGTAGCCCCTGTTTGAGATGCAGTACTGTAATAACAAGCCTTGTGTAAAATGGGCACAAATATTTCTGGCTCAGACAGAGGTCTTAGAACTTGCAAAGTCCAGGGAAGTGTGAGGGGATAATTTGATGGAATAAACTAAAGGAGGTGTTGCCCGTTTTGACCATGGTGT .........................................................................................(((((((((.((((....)))).......((((..........))))..............)))))))))........................................................................................... .........................................................................................90....................................................................................176........................................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR040024(GSM532909) G613N. (cervix) | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR040014(GSM532899) G623N. (cervix) | TAX577744(Rovira) total RNA. (breast) | TAX577740(Rovira) total RNA. (breast) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | TAX577739(Rovira) total RNA. (breast) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040032(GSM532917) G603N. (cervix) | TAX577738(Rovira) total RNA. (breast) | SRR040029(GSM532914) G026T. (cervix) | SRR040016(GSM532901) G645N. (cervix) | SRR191482(GSM715592) 5genomic small RNA (size selected RNA from to. (breast) | SRR040036(GSM532921) G243N. (cervix) | SRR189782 | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver) | SRR189785 | SRR040008(GSM532893) G727N. (cervix) | SRR040022(GSM532907) G575N. (cervix) | TAX577590(Rovira) total RNA. (breast) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR191443(GSM715553) 108genomic small RNA (size selected RNA from . (breast) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553574(SRX182780) source: Heart. (Heart) | TAX577743(Rovira) total RNA. (breast) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | GSM532877(GSM532877) G691N. (cervix) | TAX577580(Rovira) total RNA. (breast) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | GSM532876(GSM532876) G547T. (cervix) | TAX577588(Rovira) total RNA. (breast) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040010(GSM532895) G529N. (cervix) | TAX577746(Rovira) total RNA. (breast) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | GSM532929(GSM532929) G702N. (cervix) | SRR040011(GSM532896) G529T. (cervix) | SRR343336 | GSM532871(GSM532871) G652N. (cervix) | SRR039618(GSM531981) HBV(+) Side Tissue Sample 1. (liver) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR191434(GSM715544) 171genomic small RNA (size selected RNA from . (breast) | GSM450609(GSM450609) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330909(SRX091747) tissue: normal skindisease state: normal. (skin) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR363676(GSM830253) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | TAX577742(Rovira) total RNA. (breast) | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR553576(SRX182782) source: Testis. (testes) | TAX577579(Rovira) total RNA. (breast) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191635(GSM715745) 9genomic small RNA (size selected RNA from to. (breast) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | TAX577745(Rovira) total RNA. (breast) | GSM450598(GSM450598) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..............................................................................................TGAGATGCAGTACTGTAGCT........................................................................................................................................ | 20 | 56.00 | 0.00 | 5.00 | 3.00 | 4.00 | 2.00 | 1.00 | 2.00 | 1.00 | - | 1.00 | 2.00 | 1.00 | 1.00 | - | 1.00 | - | 2.00 | - | - | - | - | - | - | - | 1.00 | 2.00 | 1.00 | 1.00 | 2.00 | 1.00 | 2.00 | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | 1.00 | 1.00 | 1.00 | 1.00 | - | - | - | - | 1.00 | 1.00 | - | - | - | 1.00 | 1.00 | - | 1.00 | - | 1.00 | 1.00 | 1.00 | - | - | 1.00 | - | - | 1.00 | 1.00 | - | 1.00 | 1.00 | - | 1.00 | - | - | - | |
| ..............................................................................................TGAGATGCAGTACTGTAGCTC....................................................................................................................................... | 21 | 13.00 | 0.00 | 3.00 | 1.00 | - | - | 1.00 | - | 1.00 | - | - | - | 1.00 | - | - | - | 1.00 | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................TGAGATGCAGTACTGTAGCAA....................................................................................................................................... | 21 | 5.00 | 0.00 | - | 2.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................TGAGATGCAGTACTGTAGC......................................................................................................................................... | 19 | 4.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................TGAGATGCAGTACTGTCGCT........................................................................................................................................ | 20 | 4.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | |
| ...................................................................................................TGCAGTACTGTAATAACTGA................................................................................................................................... | 20 | 3.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................................................TGTGAGGGGATAATTTGATGGAATAA................................... | 26 | 1 | 3.00 | 3.00 | - | - | - | - | - | - | - | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...GGAGGCTTTGAAGTCGCGA.................................................................................................................................................................................................................................... | 19 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..TGGAGGCTTTGAAGTCGGG..................................................................................................................................................................................................................................... | 19 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................TGAGATGCAGTACTGTGGCT........................................................................................................................................ | 20 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................TGAGATGCAGTACTGTAGCA........................................................................................................................................ | 20 | 2.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................TGAGATGCAGTACTGTAGCTT....................................................................................................................................... | 21 | 2.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................TGAGATGCAGTACTGTAGTT........................................................................................................................................ | 20 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | |
| ..............................................................................................TGAGATGCAGTACTGTAGCTG....................................................................................................................................... | 21 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................TGAGATGCAGTACTGTAG.......................................................................................................................................... | 18 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | |
| ...........................................................................................................................................................ACAGAGGTCTTAGAACT.............................................................................. | 17 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................TGAGATGCAGTACTGTAAA......................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................TGAGATGCAGTACTGTAGCGC....................................................................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................TGAGATGCAGTACTGTATCT........................................................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................TGAGATGCAGTACTGTAGAT........................................................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................TGAGATGCAGTACTGTAGCTA....................................................................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................TGCAGTACTGTAATAACT..................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................TGAGATGCAGTACTGTAGAAA....................................................................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................TGAGATGCAGTACTGTAAAGA....................................................................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................ACAGAGGTCTTAGAACTTGC........................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - |
| ...................................................................................................TGCAGTACTGTAATAACTGAA.................................................................................................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................................AGGTCTTAGAACTTGCAAAGTCCAGGG................................................................ | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................TGAGATGCAGTACTGTCAA......................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................TGAGATGCAGTACTGTACCCC....................................................................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................TGCAGTACTGTAATAGCTG.................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................TGAGATGCAGTACTGTCGC......................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................TGCAGTACTGTAATAACGCA................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................TGAGATGCAGTACTGTTAAA........................................................................................................................................ | 20 | 1.00 | 0.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...GGAGGCTTTGAAGTCGC...................................................................................................................................................................................................................................... | 17 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..TGGAGGCTTTGAAGTCAACA.................................................................................................................................................................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................TGAGATGCAGTACTGTCA.......................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................TGAGATGCAGTACTGTAACTT....................................................................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................TGAGATGCAGTACTGTATCTC....................................................................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................TGAGATGCAGTACTGTCCCT........................................................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................TGAGATGCAGTACTGGAGC......................................................................................................................................... | 19 | 1.00 | 0.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................TGAGATGCAGTACTGTAGT......................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................TGAGATGCAGTACTGCATC......................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................TGAGATGCAGTACTGTAACT........................................................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..TGGAGGCTTTGAAGTCAAG..................................................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................TGAGATGCAGTACTGTGGT......................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .CTGGAGGCTTTGAAGT......................................................................................................................................................................................................................................... | 16 | 8 | 0.12 | 0.12 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.12 |
| TCTGGAGGCTTTGAAGTCAACAAGAATAATTCCTTCCATATCAACATGAGGTAAGTTTGAGACTCTAAATATAGACAAAAAGGTAGCCCCTGTTTGAGATGCAGTACTGTAATAACAAGCCTTGTGTAAAATGGGCACAAATATTTCTGGCTCAGACAGAGGTCTTAGAACTTGCAAAGTCCAGGGAAGTGTGAGGGGATAATTTGATGGAATAAACTAAAGGAGGTGTTGCCCGTTTTGACCATGGTGT .........................................................................................(((((((((.((((....)))).......((((..........))))..............)))))))))........................................................................................... .........................................................................................90....................................................................................176........................................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR040024(GSM532909) G613N. (cervix) | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | SRR553575(SRX182781) source: Kidney. (Kidney) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR040014(GSM532899) G623N. (cervix) | TAX577744(Rovira) total RNA. (breast) | TAX577740(Rovira) total RNA. (breast) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | TAX577739(Rovira) total RNA. (breast) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040032(GSM532917) G603N. (cervix) | TAX577738(Rovira) total RNA. (breast) | SRR040029(GSM532914) G026T. (cervix) | SRR040016(GSM532901) G645N. (cervix) | SRR191482(GSM715592) 5genomic small RNA (size selected RNA from to. (breast) | SRR040036(GSM532921) G243N. (cervix) | SRR189782 | SRR039617(GSM531980) HBV(+) Adjacent Tissue Sample 1. (liver) | SRR189785 | SRR040008(GSM532893) G727N. (cervix) | SRR040022(GSM532907) G575N. (cervix) | TAX577590(Rovira) total RNA. (breast) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | SRR191443(GSM715553) 108genomic small RNA (size selected RNA from . (breast) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553574(SRX182780) source: Heart. (Heart) | TAX577743(Rovira) total RNA. (breast) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | GSM532877(GSM532877) G691N. (cervix) | TAX577580(Rovira) total RNA. (breast) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) | GSM532876(GSM532876) G547T. (cervix) | TAX577588(Rovira) total RNA. (breast) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040010(GSM532895) G529N. (cervix) | TAX577746(Rovira) total RNA. (breast) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | GSM450601(GSM450601) miRNA sequencing raw reads from post-mortem s. (brain) | GSM532929(GSM532929) G702N. (cervix) | SRR040011(GSM532896) G529T. (cervix) | SRR343336 | GSM532871(GSM532871) G652N. (cervix) | SRR039618(GSM531981) HBV(+) Side Tissue Sample 1. (liver) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR191434(GSM715544) 171genomic small RNA (size selected RNA from . (breast) | GSM450609(GSM450609) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330909(SRX091747) tissue: normal skindisease state: normal. (skin) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR363676(GSM830253) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | TAX577742(Rovira) total RNA. (breast) | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR553576(SRX182782) source: Testis. (testes) | TAX577579(Rovira) total RNA. (breast) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR330902(SRX091740) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR191635(GSM715745) 9genomic small RNA (size selected RNA from to. (breast) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | GSM450599(GSM450599) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | TAX577745(Rovira) total RNA. (breast) | GSM450598(GSM450598) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ................................................AGGTAAGTTTGAGACTGC........................................................................................................................................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |