| (2) B-CELL | (3) BRAIN | (9) BREAST | (4) CELL-LINE | (2) CERVIX | (4) HEART | (1) LIVER | (3) OTHER | (38) SKIN | (1) TESTES | (3) UTERUS |
| GCGATTCTAATTAGTAAATTTCCATCTCTTTCTCAATAGGTATCCTCCAGTCAAAGCAATCAGCTATCCTCATCACACTGGTTCCATTGCCAAAAAAATAACTGTATCATAAAACTCTAGTAAAAGTGATGATGGTTAAGACAACAAGAGAGCAGAACGAGGTTTTATTTGGTGCTAATGACCTGCATTCTCTCTCTTAGGTCCGTGGCACTCAGGTAGTTGGTTCTGACATGACTGTGACAGTTGAGTT .................................................................................................................................................(((((((.((((..(((((....(((....))).)))))...))))))))))).................................................... .........................................................................................................................................138...........................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR039191(GSM494810) PBMCs were isolated by ficoll gradient from t. (blood) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR553576(SRX182782) source: Testis. (testes) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR330875(SRX091713) tissue: skin psoriatic involveddisease state:. (skin) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR039636(GSM518473) THP1_cyto_sRNAs. (cell line) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | TAX577589(Rovira) total RNA. (breast) | SRR189784 | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | TAX577738(Rovira) total RNA. (breast) | TAX577579(Rovira) total RNA. (breast) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | GSM532886(GSM532886) G850T. (cervix) | SRR191607(GSM715717) 192genomic small RNA (size selected RNA from . (breast) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450597(GSM450597) miRNA sequencing raw reads from post-mortem s. (brain) | TAX577739(Rovira) total RNA. (breast) | SRR040036(GSM532921) G243N. (cervix) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | TAX577741(Rovira) total RNA. (breast) | TAX577744(Rovira) total RNA. (breast) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189782 | TAX577740(Rovira) total RNA. (breast) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR343337 | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR191495(GSM715605) 159genomic small RNA (size selected RNA from . (breast) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450609(GSM450609) miRNA sequencing raw reads from post-mortem s. (brain) | SRR189777(GSM714637) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | GSM450604(GSM450604) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR553574(SRX182780) source: Heart. (Heart) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..............................................................................................................................................AACAAGAGAGCAGAACGAGGTT...................................................................................... | 22 | 1 | 17.00 | 17.00 | - | 3.00 | 1.00 | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | 1.00 | - | - | - | 2.00 | - | - | 1.00 | - | - | - | 1.00 | - | 1.00 | - | - | 1.00 | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................ACAAGAGAGCAGAACGAGGTT...................................................................................... | 21 | 1 | 10.00 | 10.00 | 2.00 | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................TGACCTGCATTCTCTCTCTTAGA................................................. | 23 | 1 | 7.00 | 5.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................ACAAGAGAGCAGAACGAGGTTT..................................................................................... | 22 | 1 | 6.00 | 6.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................TGACCTGCATTCTCTCTCTTAG.................................................. | 22 | 1 | 5.00 | 5.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................AACAAGAGAGCAGAACGAGGTTA..................................................................................... | 23 | 1 | 5.00 | 17.00 | - | 1.00 | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................ACAAGAGAGCAGAACGAGGTTTT.................................................................................... | 23 | 1 | 3.00 | 3.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - |
| ..................................................................................................................................................................................TGACCTGCATTCTCTCTCTTAGT................................................. | 23 | 1 | 2.00 | 5.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................AACAAGAGAGCAGAACGAG......................................................................................... | 19 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................AACAAGAGAGCAGAACGAGGTTTT.................................................................................... | 24 | 1 | 2.00 | 2.00 | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................................................................................................................AGTTGGTTCTGACATGAC............... | 18 | 1 | 2.00 | 2.00 | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................AACAAGAGAGCAGAACGAGGTTAA.................................................................................... | 24 | 1 | 2.00 | 17.00 | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................................................................AACAAGAGAGCAGAACGAGGTTT..................................................................................... | 23 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................................................................................................................AGTTGGTTCTGACATGACTGT............ | 21 | 1 | 2.00 | 2.00 | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................................................................TTGGTTCTGACATGACTGTGACAGT...... | 25 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................AAGAGAGCAGAACGAGGTTA..................................................................................... | 20 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................................................................................................................TTGGTTCTGACATGAC............... | 16 | 2 | 1.50 | 1.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................................................................TGACTGTGACAGTTGAGT. | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - |
| ..........................................................................................................................................................................................................CCGTGGCACTCAGGTAGTTGG........................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................................................................TGACATGACTGTGACAG....... | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................................TCAGGTAGTTGGTTCTGACATGACTGTGACAGT...... | 33 | 1 | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................................................................AGGTAGTTGGTTCTGACATGACTGTG........... | 26 | 1 | 1.00 | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................................TCAGGTAGTTGGTTCTGACA................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - |
| .........................................................................................................................AAAAGTGATGATGGTGCAG.............................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..........................................................................................................TCATAAAACTCTAGTGGGC............................................................................................................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................................................TAAAAGTGATGATGGTTGAGA............................................................................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................AACAAGAGAGCAGAACGAGGT....................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................................................CAGGTAGTTGGTTCTGACACT................. | 21 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................................................................GTTCTGACATGACTGTGACAG....... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................................................................TGGCACTCAGGTAGTTGGTTCTGACA................... | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................................................................................................................................................................................................CCGTGGCACTCAGGT................................. | 15 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................................................................TTGGTTCTGACATGACTGTGACAGTT..... | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................................TCAGGTAGTTGGTTCTGGGGT.................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................TTTCCATCTCTTTCTCCAAG.................................................................................................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | |
| ...............................................................................................................................................ACAAGAGAGCAGAACGAGGTTA..................................................................................... | 22 | 1 | 1.00 | 10.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................................................................AGGTAGTTGGTTCTGACG................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | |
| ...........................................................................................................................................................................................................................TTGGTTCTGACATGACTGTGACAG....... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................ACAAGAGAGCAGAACGAGGT....................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................AAGAGAGCAGAACGAGGTTTT.................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................TCCAGTCAAAGCAATCAGCTATCCTCA.................................................................................................................................................................................. | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - |
| ............................................................................................................................................................................................................................TGGTTCTGACATGACTGTGACAGTTCAG.. | 28 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................CAAGAGAGCAGAACGAGGAAA..................................................................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................................................................GTGGCACTCAGGTAGTTGG........................... | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................................................GTAGTTGGTTCTGACATGACT.............. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................................................................GGTAGTTGGTTCTGACATG................. | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................AAATAACTGTATCATAAAGATT..................................................................................................................................... | 22 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................GAGAGCAGAACGAGGT....................................................................................... | 16 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - |
| ................................................................................................................................................................................................................................TCTGACATGACTGTGAC......... | 17 | 3 | 0.33 | 0.33 | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................................................................................................TGACTGTGACAGTTG.... | 15 | 6 | 0.17 | 0.17 | - | - | - | - | - | - | 0.17 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...........................................................................................................................................................................................................CGTGGCACTCAGGT................................. | 14 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| GCGATTCTAATTAGTAAATTTCCATCTCTTTCTCAATAGGTATCCTCCAGTCAAAGCAATCAGCTATCCTCATCACACTGGTTCCATTGCCAAAAAAATAACTGTATCATAAAACTCTAGTAAAAGTGATGATGGTTAAGACAACAAGAGAGCAGAACGAGGTTTTATTTGGTGCTAATGACCTGCATTCTCTCTCTTAGGTCCGTGGCACTCAGGTAGTTGGTTCTGACATGACTGTGACAGTTGAGTT .................................................................................................................................................(((((((.((((..(((((....(((....))).)))))...))))))))))).................................................... .........................................................................................................................................138...........................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR039191(GSM494810) PBMCs were isolated by ficoll gradient from t. (blood) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR553576(SRX182782) source: Testis. (testes) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR330883(SRX091721) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR330875(SRX091713) tissue: skin psoriatic involveddisease state:. (skin) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330881(SRX091719) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR039636(GSM518473) THP1_cyto_sRNAs. (cell line) | SRR330921(SRX091759) tissue: normal skindisease state: normal. (skin) | SRR094132(GSM651908) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | TAX577589(Rovira) total RNA. (breast) | SRR189784 | SRR039621(GSM531984) HBV(+) HCC Tissue Sample 2. (liver) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR094129(GSM651905) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | TAX577738(Rovira) total RNA. (breast) | TAX577579(Rovira) total RNA. (breast) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR330908(SRX091746) tissue: normal skindisease state: normal. (skin) | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | GSM532886(GSM532886) G850T. (cervix) | SRR191607(GSM715717) 192genomic small RNA (size selected RNA from . (breast) | SRR330867(SRX091705) tissue: skin psoriatic involveddisease state:. (skin) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450597(GSM450597) miRNA sequencing raw reads from post-mortem s. (brain) | TAX577739(Rovira) total RNA. (breast) | SRR040036(GSM532921) G243N. (cervix) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | TAX577741(Rovira) total RNA. (breast) | TAX577744(Rovira) total RNA. (breast) | SRR330915(SRX091753) tissue: normal skindisease state: normal. (skin) | SRR330874(SRX091712) tissue: skin psoriatic involveddisease state:. (skin) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | SRR330886(SRX091724) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR189782 | TAX577740(Rovira) total RNA. (breast) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR330910(SRX091748) tissue: normal skindisease state: normal. (skin) | SRR330890(SRX091728) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR343337 | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | SRR330862(SRX091700) tissue: skin psoriatic involveddisease state:. (skin) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR330898(SRX091736) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330903(SRX091741) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR330907(SRX091745) tissue: normal skindisease state: normal. (skin) | SRR191495(GSM715605) 159genomic small RNA (size selected RNA from . (breast) | SRR330891(SRX091729) tissue: skin psoriatic uninvolveddisease stat. (skin) | GSM450609(GSM450609) miRNA sequencing raw reads from post-mortem s. (brain) | SRR189777(GSM714637) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | GSM450604(GSM450604) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330899(SRX091737) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR553574(SRX182780) source: Heart. (Heart) | SRR330879(SRX091717) tissue: skin psoriatic involveddisease state:. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..............................................................................TGGTTCCATTGCCAAACAC......................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................TTTTATTTGGTGCTATCGG..................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ............................................................................................AAAAAATAACTGTATCTC............................................................................................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | |
| ..............................................................................TGGTTCCATTGCCAAACACT........................................................................................................................................................ | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...........................................................................................................................AAGTGATGATGGTTAAAG............................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................GGTATCCTCCAGTCA..................................................................................................................................................................................................... | 15 | 3 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - |
| .........................CTCTTTCTCAATAGG.................................................................................................................................................................................................................. | 15 | 10 | 0.10 | 0.10 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.10 |