| (1) AGO1.ip | (1) AGO1.ip OTHER.mut | (2) B-CELL | (2) BRAIN | (4) BREAST | (22) CELL-LINE | (2) CERVIX | (1) FIBROBLAST | (4) HEART | (2) HELA | (2) LIVER | (2) OTHER | (13) SKIN | (1) TESTES | (1) XRN.ip |
| TACAGTTGGTAAGTCCATGGGTTGGTATCTGAGAGGATTATCTCTGAATTCTCTGAAATTGTGAGAAACATGGTGTGTATATGGTATTTTTCTGAGCATGGCTGTAGCTTTCATCAGAATCTCAAAGGAAGCCCCTGTCCCAGGCTGTGGGACCTGGGGTGCAAGTGCAAGAGCAACAGCCACTCACCCCAAACCCCAAGGTTCCTGCAGACAGCAGAGATGGTGAAGCCCTCCACCCCATCCCCCAGCC ...................................................................................................................................................((((...(((((((..((((.....((....)))))))))))))...)))).................................................... ............................................................................................................................................141........................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR207113(GSM721075) IP against AGO 1 & 2. (ago1/2 cell line) | SRR207114(GSM721076) "IP against AGO 1 & 2, RRP40 knockdown". (ago1/2 RRP40 cell line) | DRR001486(DRX001040) "Hela long cytoplasmic cell fraction, LNA(+)". (hela) | SRR189782 | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR037937(GSM510475) 293cand2. (cell line) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR189787 | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR207116(GSM721078) Nuclear RNA. (cell line) | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR037933(GSM510471) 293cand4_rep2. (cell line) | SRR189786 | SRR343333(GSM796036) KSHV (HHV8). (cell line) | GSM450603(GSM450603) miRNA sequencing raw reads from post-mortem s. (brain) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR553576(SRX182782) source: Testis. (testes) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR037934(GSM510472) 293cand4_rep3. (cell line) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR191625(GSM715735) 32genomic small RNA (size selected RNA from t. (breast) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR363675(GSM830252) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR033716(GSM497061) Mentle Cell Lymphoma (MCL114). (B cell) | SRR040032(GSM532917) G603N. (cervix) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577588(Rovira) total RNA. (breast) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR040035(GSM532920) G001T. (cervix) | SRR037936(GSM510474) 293cand1. (cell line) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | DRR001487(DRX001041) "Hela long nuclear cell fraction, LNA(+)". (hela) | SRR191601(GSM715711) 58genomic small RNA (size selected RNA from t. (breast) | SRR029126(GSM416755) 143B. (cell line) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR189784 | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | TAX577453(Rovira) total RNA. (breast) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | GSM450610(GSM450610) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR343334 | SRR343335 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .................................................................................................................................................TGTGGGACCTGGGGTGCAAGTGC.................................................................................. | 23 | 1 | 16.00 | 16.00 | 3.00 | - | - | - | 2.00 | 2.00 | - | - | 1.00 | 1.00 | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................TGTGGGACCTGGGGTGCAAGTG................................................................................... | 22 | 1 | 13.00 | 13.00 | - | 6.00 | - | - | 2.00 | - | - | - | 1.00 | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................GCCACTCACCCCAAACCCCAAG.................................................. | 22 | 1 | 12.00 | 12.00 | - | - | - | - | 1.00 | - | 4.00 | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - |
| ..................................................................................................................................................GTGGGACCTGGGGTGCAAGTGCA................................................................................. | 23 | 1 | 11.00 | 11.00 | - | 3.00 | - | - | - | - | - | - | - | - | - | 3.00 | - | - | - | - | - | 1.00 | - | 2.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - |
| ..................................................................................................................................................GTGGGACCTGGGGTGCAAGTGC.................................................................................. | 22 | 1 | 8.00 | 8.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................CCCCTGTCCCAGGCTGTGGGACCTGGGGTGCAAGTGCAAGAGCAACAGCCACTCACCCCAAACCCC..................................................... | 66 | 1 | 8.00 | 8.00 | - | - | 8.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................GTGGGACCTGGGGTGCAAGTG................................................................................... | 21 | 1 | 6.00 | 6.00 | 4.00 | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................CCACTCACCCCAAACCCCAAGA................................................. | 22 | 1 | 4.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | 1.00 | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................................................AGCCACTCACCCCAAACCCCAAG.................................................. | 23 | 1 | 4.00 | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - |
| .................................................................................................................................................TGTGGGACCTGGGGTGCAAGTGCA................................................................................. | 24 | 1 | 3.00 | 3.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................GCCACTCACCCCAAACCCCAAGA................................................. | 23 | 1 | 2.00 | 12.00 | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................GTGGGACCTGGGGTGCAAGCGC.................................................................................. | 22 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | |
| ..........................................................................................................................................................................GAGCAACAGCCACTCACCCCAAACCCCAAG.................................................. | 30 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................................ACAGCCACTCACCCCAAACCCCAAGGTTCCGC........................................... | 32 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................CCACTCACCCCAAACCCTAAG.................................................. | 21 | 2.00 | 0.00 | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ....................................................................................................................................................................................CACTCACCCCAAACCCCAAGAT................................................ | 22 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................CTGTGGGACCTGGGGTGCAAGTGCC................................................................................. | 25 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................TGTGGGACCTGGGGTGCAAGTAA.................................................................................. | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................TGTGGGACCTGGGGTGCAAGT.................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................TGTGGGACCTGGGGTGCAAGTGCAT................................................................................ | 25 | 1 | 1.00 | 3.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................ATGGCTGTAGCTTTCATCAGAATCTCA.............................................................................................................................. | 27 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................CCACTCACCCCAAACCCCAAG.................................................. | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................CACTCACCCCAAACCCCCCGA................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................CCACTCACCCCAAACCCCAAT.................................................. | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............CCATGGGTTGGTATCTGAGAG....................................................................................................................................................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - |
| ..................................................................................................................................................GTGGGACCTGGGGTGCAAGTGA.................................................................................. | 22 | 1 | 1.00 | 6.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................AAATTGTGAGAAACATGGTGTGTATA......................................................................................................................................................................... | 26 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - |
| ....................GTTGGTATCTGAGAGTAGA................................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................TGTGGGACCTGGGGTGCAAG..................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................................................CAGCCACTCACCCCAAACCCCAAG.................................................. | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......................................................................................................................................................ACCTGGGGTGCAAGTGCAAGAGCA........................................................................... | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................CCACTCACCCCAAACCCCAAGC................................................. | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - |
| .......GGTAAGTCCATGGGTTGGTATCT............................................................................................................................................................................................................................ | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................................AGCATGGCTGTAGCTTTCATCAG..................................................................................................................................... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................GTATTTTTCTGAGCATGGCTGTAGCTTTCATCAGAATCTCAAAGGAAGCCCCTGTCCCAGGCTGTGGGACCTGGGGTGCAAGTG................................................................................... | 84 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................TGGCTGTAGCTTTCATCAGAATCTCAAAG........................................................................................................................... | 29 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................TGTGGGACCTGGGGTGCAAGTAG.................................................................................. | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - |
| ...................................................................................................................................................................................CCACTCACCCCAAACCCCAAGT................................................. | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................................ACTCACCCCAAACCCCAAGTT................................................ | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................................................................TGTGGGACCTGGGGTGCAAGTGT.................................................................................. | 23 | 1 | 1.00 | 13.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ......................................................................................................................................................................................CTCACCCCAAACCCCAAGATT............................................... | 21 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...AGTTGGTAAGTCCATGGGC.................................................................................................................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................TGGTATTTTTCTGAGCATGGC.................................................................................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| TACAGTTGGTAAGTCCATGGGTTGGTATCTGAGAGGATTATCTCTGAATTCTCTGAAATTGTGAGAAACATGGTGTGTATATGGTATTTTTCTGAGCATGGCTGTAGCTTTCATCAGAATCTCAAAGGAAGCCCCTGTCCCAGGCTGTGGGACCTGGGGTGCAAGTGCAAGAGCAACAGCCACTCACCCCAAACCCCAAGGTTCCTGCAGACAGCAGAGATGGTGAAGCCCTCCACCCCATCCCCCAGCC ...................................................................................................................................................((((...(((((((..((((.....((....)))))))))))))...)))).................................................... ............................................................................................................................................141........................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR207113(GSM721075) IP against AGO 1 & 2. (ago1/2 cell line) | SRR207114(GSM721076) "IP against AGO 1 & 2, RRP40 knockdown". (ago1/2 RRP40 cell line) | DRR001486(DRX001040) "Hela long cytoplasmic cell fraction, LNA(+)". (hela) | SRR189782 | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR037937(GSM510475) 293cand2. (cell line) | DRR000555(DRX000313) "THP-1 whole cell RNA, no treatment". (cell line) | DRR000557(DRX000315) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR189787 | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR207116(GSM721078) Nuclear RNA. (cell line) | DRR000556(DRX000314) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR330905(SRX091743) tissue: normal skindisease state: normal. (skin) | SRR037933(GSM510471) 293cand4_rep2. (cell line) | SRR189786 | SRR343333(GSM796036) KSHV (HHV8). (cell line) | GSM450603(GSM450603) miRNA sequencing raw reads from post-mortem s. (brain) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR553576(SRX182782) source: Testis. (testes) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR037934(GSM510472) 293cand4_rep3. (cell line) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR039625(GSM531988) HBV(-) HCV(-) HCC Tissue Sample. (liver) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | SRR330861(SRX091699) tissue: skin psoriatic involveddisease state:. (skin) | SRR191625(GSM715735) 32genomic small RNA (size selected RNA from t. (breast) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR107297(GSM677704) 18-30nt fraction of small RNA. (cell line) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | SRR363675(GSM830252) cell type: human foreskin fibroblasts (HFF)tr. (fibroblast) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | SRR033716(GSM497061) Mentle Cell Lymphoma (MCL114). (B cell) | SRR040032(GSM532917) G603N. (cervix) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR330901(SRX091739) tissue: skin psoriatic uninvolveddisease stat. (skin) | TAX577588(Rovira) total RNA. (breast) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR040035(GSM532920) G001T. (cervix) | SRR037936(GSM510474) 293cand1. (cell line) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | DRR001487(DRX001041) "Hela long nuclear cell fraction, LNA(+)". (hela) | SRR191601(GSM715711) 58genomic small RNA (size selected RNA from t. (breast) | SRR029126(GSM416755) 143B. (cell line) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR330865(SRX091703) tissue: skin psoriatic involveddisease state:. (skin) | SRR189784 | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330869(SRX091707) tissue: skin psoriatic involveddisease state:. (skin) | TAX577453(Rovira) total RNA. (breast) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR326282(GSM769512) "Dicer mRNA was knocked down using siDicer, t. (cell line) | GSM450610(GSM450610) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR343334 | SRR343335 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .............................................................................................................................................................GGTGCAAGTGCAAGATGCG.......................................................................... | 19 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .............................................................................................................................................................GGTGCAAGTGCAAGATTCC.......................................................................... | 19 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ......................................................................................................................................................................GCAAGAGCAACAGCCAGG.................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................AAGTGCAAGAGCAACATT...................................................................... | 18 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .....................................................................................................CTGTAGCTTTCATCAGAGTA................................................................................................................................. | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................CATGGCTGTAGCTTT........................................................................................................................................... | 15 | 5 | 0.40 | 0.40 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.20 | 0.20 |