| (3) B-CELL | (1) BRAIN | (8) BREAST | (16) CELL-LINE | (4) CERVIX | (8) HEART | (3) LIVER | (2) OTHER | (1) RRP40.ip | (27) SKIN | (1) TESTES | (1) UTERUS | (1) XRN.ip |
| GGCACAAAGGGAGTTGAGTTGCATCTTTATTACCCACGCCCTAGCTGTTCACCTCCTTTTAGGAATTTCGTGGTACCATGTAAGACAATGAATTATATTTTAAAAAACCATCGTCTTACTTTGTACAATTTGTCTGTGCATGAAATGTGACCAGGGTACATGATTTCTACTAATGAACATCGGTGCTCATGTTCACACAGGTTCACCAGAGTGGCTCAGGCTGGTCTCCAGTGGTGAGTTTTCACCTCTT .................................................................................................................................................(((((.((((((((.(((((((.......))).)))))))))).)).)))))..................................................... ............................................................................................................................................141........................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR191607(GSM715717) 192genomic small RNA (size selected RNA from . (breast) | SRR189782 | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR037935(GSM510473) 293cand3. (cell line) | SRR037937(GSM510475) 293cand2. (cell line) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | TAX577739(Rovira) total RNA. (breast) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR037936(GSM510474) 293cand1. (cell line) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR033724(GSM497069) L428 cell line (L428). (B cell) | SRR189787 | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040028(GSM532913) G026N. (cervix) | SRR040032(GSM532917) G603N. (cervix) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR060984(GSM569188) Human plasma cell [09-001]. (cell line) | SRR039612(GSM531975) Human Normal Liver Tissue Sample 2. (liver) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR444058(SRX128906) Sample 16cDNABarcode: AF-PP-335: ACG CTC TTC . (skin) | SRR029132(GSM416761) MB-MDA231. (cell line) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR060168(GSM565978) 5-8F_nucleus. (cell line) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR191566(GSM715676) 94genomic small RNA (size selected RNA from t. (breast) | GSM532890(GSM532890) G576T. (cervix) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR037942(GSM510480) 293DroshaTN_cand5. (cell line) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | TAX577740(Rovira) total RNA. (breast) | SRR191582(GSM715692) 95genomic small RNA (size selected RNA from t. (breast) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR033731(GSM497076) h929 Cell line (h929). (B cell) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR191551(GSM715661) 32genomic small RNA (size selected RNA from t. (breast) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR189785 | TAX577738(Rovira) total RNA. (breast) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR040024(GSM532909) G613N. (cervix) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR191406(GSM715516) 67genomic small RNA (size selected RNA from t. (breast) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR553576(SRX182782) source: Testis. (testes) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ......................................................................................AATGAATTATATTTTTGCG................................................................................................................................................. | 19 | 23.00 | 0.00 | 23.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................TCGGTGCTCATGTTCACACAGA................................................. | 22 | 1 | 23.00 | 4.00 | - | - | 3.00 | - | - | - | 2.00 | - | 1.00 | - | - | - | - | 1.00 | 2.00 | - | 1.00 | - | 2.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | 1.00 | 1.00 | - | - | 1.00 | - | - | - | 1.00 | - | - | 1.00 | - | 1.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................TCGGTGCTCATGTTCACACAGT................................................. | 22 | 1 | 14.00 | 4.00 | - | 1.00 | 1.00 | - | - | - | - | - | 1.00 | 3.00 | 3.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................TGTGACCAGGGTACATGATTT.................................................................................... | 21 | 1 | 4.00 | 4.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - |
| ...................................................................................................................................................................................TCGGTGCTCATGTTCACACAG.................................................. | 21 | 1 | 4.00 | 4.00 | - | 2.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................TGTGACCAGGGTACATGATT..................................................................................... | 20 | 1 | 3.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .....................................................................................................................................................................................GGTGCTCATGTTCACACAGA................................................. | 20 | 3.00 | 0.00 | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................................................................................................................................................................TCGGTGCTCATGTTCACACAGTA................................................ | 23 | 1 | 3.00 | 4.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - |
| ...............................................................................................................................................AATGTGACCAGGGTACATGATT..................................................................................... | 22 | 1 | 3.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - |
| ................................................................................................................................................ATGTGACCAGGGTACATGATTT.................................................................................... | 22 | 1 | 3.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - |
| ..................................................................................................................................................................................ATCGGTGCTCATGTTCACACAG.................................................. | 22 | 1 | 3.00 | 3.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................................................ATGTGACCAGGGTACATG........................................................................................ | 18 | 1 | 2.00 | 2.00 | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................................................................TGTGACCAGGGTACATGA....................................................................................... | 18 | 1 | 2.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........GAGTTGAGTTGCATCAAG.............................................................................................................................................................................................................................. | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................ATGTGACCAGGGTACATGAT...................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ........................................................................................................................................................................ACTAATGAACATCGG................................................................... | 15 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................ATCGGTGCTCATGTTCACACAGC................................................. | 23 | 1 | 1.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................ATGATTTCTACTAATTAA......................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................AAATGTGACCAGGGTAC........................................................................................... | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................................................................................................................ATCGGTGCTCATGTTCACAC.................................................... | 20 | 1 | 1.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................................................TGGCTCAGGCTGGTCGGAA.................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................................................................................................ATCGGTGCTCATGTTCACA..................................................... | 19 | 1 | 1.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................AATGTGACCAGGGTACATGA....................................................................................... | 20 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................TCGGTGCTCATGTTCACA..................................................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................AATGTGACCAGGGTACATGAT...................................................................................... | 21 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - |
| ............................................................................................................................................................................................................ACCAGAGTGGCTCAGGC............................. | 17 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - |
| .........................................................................................................................................................................CTAATGAACATCGG................................................................... | 14 | 4 | 0.25 | 0.25 | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ....................................................................................................................................................................................................................GGCTCAGGCTGGTCTCC..................... | 17 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 |
| GGCACAAAGGGAGTTGAGTTGCATCTTTATTACCCACGCCCTAGCTGTTCACCTCCTTTTAGGAATTTCGTGGTACCATGTAAGACAATGAATTATATTTTAAAAAACCATCGTCTTACTTTGTACAATTTGTCTGTGCATGAAATGTGACCAGGGTACATGATTTCTACTAATGAACATCGGTGCTCATGTTCACACAGGTTCACCAGAGTGGCTCAGGCTGGTCTCCAGTGGTGAGTTTTCACCTCTT .................................................................................................................................................(((((.((((((((.(((((((.......))).)))))))))).)).)))))..................................................... ............................................................................................................................................141........................................................200................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR191607(GSM715717) 192genomic small RNA (size selected RNA from . (breast) | SRR189782 | SRR342894(SRX096790) small RNA seq of Right atrial tissue. (heart) | SRR342895(SRX096791) small RNA seq of Left atrial tissue. (heart) | SRR037935(GSM510473) 293cand3. (cell line) | SRR037937(GSM510475) 293cand2. (cell line) | SRR207115(GSM721077) XRN1&2 knockdown. (XRN1/XRN2 cell line) | SRR342901(SRX096797) small RNA seq of Left atrial tissue. (heart) | SRR330880(SRX091718) tissue: skin psoriatic involveddisease state:. (skin) | SRR330911(SRX091749) tissue: normal skindisease state: normal. (skin) | SRR207116(GSM721078) Nuclear RNA. (cell line) | SRR342896(SRX096792) small RNA seq of Right atrial tissue. (heart) | SRR342899(SRX096795) small RNA seq of Left atrial tissue. (heart) | DRR000558(DRX000316) "THP-1 whole cell RNA, after 3 day treatment . (cell line) | SRR330858(SRX091696) tissue: skin psoriatic involveddisease state:. (skin) | TAX577739(Rovira) total RNA. (breast) | SRR330920(SRX091758) tissue: normal skindisease state: normal. (skin) | SRR330872(SRX091710) tissue: skin psoriatic involveddisease state:. (skin) | SRR330876(SRX091714) tissue: skin psoriatic involveddisease state:. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR037936(GSM510474) 293cand1. (cell line) | SRR342900(SRX096796) small RNA seq of Right atrial tissue. (heart) | SRR207111(GSM721073) Whole cell RNA. (cell line) | SRR033724(GSM497069) L428 cell line (L428). (B cell) | SRR189787 | SRR330864(SRX091702) tissue: skin psoriatic involveddisease state:. (skin) | SRR330893(SRX091731) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR040028(GSM532913) G026N. (cervix) | SRR040032(GSM532917) G603N. (cervix) | SRR342898(SRX096794) small RNA seq of Right atrial tissue. (heart) | SRR060984(GSM569188) Human plasma cell [09-001]. (cell line) | SRR039612(GSM531975) Human Normal Liver Tissue Sample 2. (liver) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR330914(SRX091752) tissue: normal skindisease state: normal. (skin) | SRR330887(SRX091725) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR330878(SRX091716) tissue: skin psoriatic involveddisease state:. (skin) | SRR444058(SRX128906) Sample 16cDNABarcode: AF-PP-335: ACG CTC TTC . (skin) | SRR029132(GSM416761) MB-MDA231. (cell line) | SRR330884(SRX091722) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR060168(GSM565978) 5-8F_nucleus. (cell line) | SRR207112(GSM721074) RRP40 knockdown. (RRP40 cell line) | SRR037944(GSM510482) 293DcrTN_cand5. (cell line) | SRR191566(GSM715676) 94genomic small RNA (size selected RNA from t. (breast) | GSM532890(GSM532890) G576T. (cervix) | SRR039622(GSM531985) HCV(+) Adjacent Tissue Sample. (liver) | SRR039616(GSM531979) HBV(+) Distal Tissue Sample 1. (liver) | SRR037942(GSM510480) 293DroshaTN_cand5. (cell line) | SRR330923(SRX091761) tissue: normal skindisease state: normal. (skin) | SRR330917(SRX091755) tissue: normal skindisease state: normal. (skin) | TAX577740(Rovira) total RNA. (breast) | SRR191582(GSM715692) 95genomic small RNA (size selected RNA from t. (breast) | SRR330895(SRX091733) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR553572(SRX182778) source: Frontal Cortex. (Frontal Cortex) | SRR033731(GSM497076) h929 Cell line (h929). (B cell) | SRR330904(SRX091742) tissue: normal skindisease state: normal. (skin) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR191551(GSM715661) 32genomic small RNA (size selected RNA from t. (breast) | SRR330912(SRX091750) tissue: normal skindisease state: normal. (skin) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) | SRR189785 | TAX577738(Rovira) total RNA. (breast) | SRR330859(SRX091697) tissue: skin psoriatic involveddisease state:. (skin) | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | SRR330871(SRX091709) tissue: skin psoriatic involveddisease state:. (skin) | SRR342897(SRX096793) small RNA seq of Left atrial tissue. (heart) | SRR094131(GSM651907) small RNA(18-35nt)small RNA deep sequencing o. (uterus) | SRR040024(GSM532909) G613N. (cervix) | SRR553573(SRX182779) source: Cerebellum. (Cerebellum) | SRR330870(SRX091708) tissue: skin psoriatic involveddisease state:. (skin) | SRR191406(GSM715516) 67genomic small RNA (size selected RNA from t. (breast) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR553576(SRX182782) source: Testis. (testes) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330897(SRX091735) tissue: skin psoriatic uninvolveddisease stat. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .................................................................................................TTTTAAAAAACCATCGTA....................................................................................................................................... | 18 | 8.00 | 0.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 2.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................TTTTAAAAAACCATCGTAAAA.................................................................................................................................... | 21 | 5.00 | 0.00 | - | - | - | - | 2.00 | 1.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................TTTTAAAAAACCATCGTAA...................................................................................................................................... | 19 | 5.00 | 0.00 | - | - | - | 1.00 | - | 2.00 | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..................................................................................................TTTAAAAAACCATCGT........................................................................................................................................ | 16 | 1 | 4.00 | 4.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................TTTTAAAAAACCATCGA........................................................................................................................................ | 17 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................TTTTAAAAAACCATCGTGAA..................................................................................................................................... | 20 | 2.00 | 0.00 | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................TTTTAAAAAACCATCGTAAA..................................................................................................................................... | 20 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | |
| ....................................................................................................TAAAAAACCATCGT........................................................................................................................................ | 14 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .................................................................................................TTTTAAAAAACCATCGAAAA..................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .......................................................................................................................................................................................TGCTCATGTTCACACAAGTG............................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................................................................................GGTCTCCAGTGGTGACGCA......... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................TTTTAAAAAACCATCGAAAC..................................................................................................................................... | 20 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................TTTTAAAAAACCATCGAAA...................................................................................................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | |
| ...................................................................................................TTAAAAAACCATCGT........................................................................................................................................ | 15 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................TTAAAAAACCATCGTGA...................................................................................................................................... | 17 | 1.00 | 0.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................TTTTAAAAAACCATCGAA....................................................................................................................................... | 18 | 1.00 | 0.00 | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| .................................................................................................TTTTAAAAAACCATCGT........................................................................................................................................ | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................................TCGGTGCTCATGTT......................................................... | 14 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - |
| ..................................................................................................TTTAAAAAACCATCG......................................................................................................................................... | 15 | 6 | 0.33 | 0.33 | - | - | - | - | - | - | - | - | - | - | - | 0.33 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................GTTCACCTCCTTTTA............................................................................................................................................................................................. | 15 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |