| (1) AGO1.ip OTHER.mut | (1) AGO2.ip | (13) B-CELL | (1) BRAIN | (7) BREAST | (18) CELL-LINE | (2) CERVIX | (1) HELA | (3) LIVER | (3) OTHER | (9) SKIN |
| ACCACGCCCAGGACCTCGGCGTTGTCAACCTCACCAACCACCTGCACCAGGTGCGGGGGCGCCTACTGGGGAGGTGGGAGGGGTTGGAAGGCAAGTGGGTCTCGGGCCTGGCTCACCCTGCTTTCATCCCCAGACGCCCCTGCACCTGGCGGTGATCACGGGGCAGACGAGTGTGGTGAGCTT ...............................................................................((((...(((((((.(((((((........)))))))..)))))))..)))).................................................... .........................................................................74.........................................................133................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | SRR033716(GSM497061) Mentle Cell Lymphoma (MCL114). (B cell) | SRR314796(SRX084354) "Total RNA, fractionated (15-30nt)". (cell line) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR060986(GSM569190) Human memory B cell [09-001]. (cell line) | SRR343334 | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR039636(GSM518473) THP1_cyto_sRNAs. (cell line) | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR060985(GSM569189) Human naive B cell [09-001]. (cell line) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | SRR039637(GSM518474) THP1_total_sRNAs. (cell line) | SRR038857(GSM458540) D20. (cell line) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR038858(GSM458541) MEL202. (cell line) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR015364(GSM380329) Plasma B cells (PC44). (B cell) | SRR040043(GSM532928) G428T. (cervix) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR207114(GSM721076) "IP against AGO 1 & 2, RRP40 knockdown". (ago1/2 RRP40 cell line) | SRR040029(GSM532914) G026T. (cervix) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | SRR015446(SRR015446) smallRNAs high-throughput sequencing Total. (breast) | TAX577738(Rovira) total RNA. (breast) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | SRR039635(GSM518472) THP1_nuc_sRNAs. (cell line) | SRR191417(GSM715527) 39genomic small RNA (size selected RNA from t. (breast) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR191421(GSM715531) 122genomic small RNA (size selected RNA from . (breast) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | SRR039615(GSM531978) Severe Chronic Hepatitis B Liver Tissue. (liver) | SRR343335 | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | TAX577746(Rovira) total RNA. (breast) | SRR189784 | TAX577453(Rovira) total RNA. (breast) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR033724(GSM497069) L428 cell line (L428). (B cell) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ..............................................................................AGGGGTTGGAAGGCAAGTGG..................................................................................... | 20 | 1 | 10.00 | 10.00 | - | 1.00 | - | - | - | - | - | 1.00 | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | 1.00 | - | - | - | - | - | - |
| ..............................................................................AGGGGTTGGAAGGCAAGTGGGT................................................................................... | 22 | 1 | 8.00 | 8.00 | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | 2.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................AGGGGTTGGAAGGCAAGTGGGTCT................................................................................. | 24 | 1 | 6.00 | 6.00 | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................AGGGGTTGGAAGGCAAGTGGAA................................................................................... | 22 | 1 | 5.00 | 10.00 | 3.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................AGGGGTTGGAAGGCAAGTGGGAA.................................................................................. | 23 | 1 | 5.00 | 3.00 | - | - | - | - | - | - | - | - | 1.00 | - | 2.00 | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................AGGGGTTGGAAGGCAAGTGGATC.................................................................................. | 23 | 1 | 5.00 | 10.00 | - | - | 5.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................AGGGGTTGGAAGGCAAGTGGGTAA................................................................................. | 24 | 1 | 4.00 | 8.00 | - | 1.00 | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..........................AACCTCACCAACCACTATG.......................................................................................................................................... | 19 | 3.00 | 0.00 | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................AGGGGTTGGAAGGCAAGTGGG.................................................................................... | 21 | 1 | 3.00 | 3.00 | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - |
| ..............................................................................AGGGGTTGGAAGGCAAGTGGGTAT................................................................................. | 24 | 1 | 3.00 | 8.00 | 1.00 | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................AGGGGTTGGAAGGCAAGTGGGTCA................................................................................. | 24 | 1 | 3.00 | 1.00 | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................CTCACCCTGCTTTCATCCCCAGT................................................. | 23 | 3.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | 1.00 | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | |
| ........................................................................................AGGCAAGTGGGTCTCGGG............................................................................. | 18 | 1 | 2.00 | 2.00 | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................AGGGGTTGGAAGGCAAGTGAA.................................................................................... | 21 | 2.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 2.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................................................................................................CGGGGCAGACGAGTGTGGTGAGCT. | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................CAGACGAGTGTGGTGAGCT. | 19 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................ACCTGGCGGTGATCACGG...................... | 18 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................GAGGGGTTGGAAGGCTGA........................................................................................ | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ................................................................................................................................................CCTGGCGGTGATCACGGGGCAGACGAGTGTGGTGA.... | 35 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................AGGGGTTGGAAGGCAAGTGGGAAA................................................................................. | 24 | 1 | 1.00 | 3.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..................................................................................GTTGGAAGGCAAGTGGGTCTCGG.............................................................................. | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................AGGGGTTGGAAGGCAAGTGGAT................................................................................... | 22 | 1 | 1.00 | 10.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ................................................................................................................TCACCCTGCTTTCATCATG.................................................... | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | |
| ............................................................................................................................................................CACGGGGCAGACGAGTGTGGTGA.... | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................................................................................................................................................ACGGGGCAGACGAGTGTGGTGA.... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - |
| ...........................................................................................................................................................TCACGGGGCAGACGAGTGTGGTGAGCC. | 27 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | |
| .............CCTCGGCGTTGTCAACCTCACCAA.................................................................................................................................................. | 24 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................AGGGGTTGGAAGGCAAGTGGGTTTA................................................................................ | 25 | 1 | 1.00 | 8.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .........AGGACCTCGGCGTTGTCAACCT........................................................................................................................................................ | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - |
| ...........................................................................................CAAGTGGGTCTCGGGCC........................................................................... | 17 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................AGGGGTTGGAAGGCAAGTGGGTC.................................................................................. | 23 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................AGGGGTTGGAAGGCAAGTGGGTA.................................................................................. | 23 | 1 | 1.00 | 8.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................AGGGGTTGGAAGGCAAGTGGGTT.................................................................................. | 23 | 1 | 1.00 | 8.00 | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ..............................................................................AGGGGTTGGAAGGCAAGTTGAA................................................................................... | 22 | 1.00 | 0.00 | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ..............................................................................AGGGGTTGGAAGGCAAGTGGGTCTT................................................................................ | 25 | 1 | 1.00 | 6.00 | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...............................................................................................................................................................GGGGCAGACGAGTGTGGG...... | 18 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ........................................................................................AGGCAAGTGGGTCTCGGGCCTG......................................................................... | 22 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| ...................................................................................................................................................................CAGACGAGTGTGGTGA.... | 16 | 1 | 1.00 | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .............................CTCACCAACCACCTGCA......................................................................................................................................... | 17 | 4 | 0.25 | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.25 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - |
| .......CCAGGACCTCGGCG.................................................................................................................................................................. | 14 | 7 | 0.14 | 0.14 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.14 | - |
| ...................................AACCACCTGCACCAG..................................................................................................................................... | 15 | 8 | 0.12 | 0.12 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.12 |
| ACCACGCCCAGGACCTCGGCGTTGTCAACCTCACCAACCACCTGCACCAGGTGCGGGGGCGCCTACTGGGGAGGTGGGAGGGGTTGGAAGGCAAGTGGGTCTCGGGCCTGGCTCACCCTGCTTTCATCCCCAGACGCCCCTGCACCTGGCGGTGATCACGGGGCAGACGAGTGTGGTGAGCTT ...............................................................................((((...(((((((.(((((((........)))))))..)))))))..)))).................................................... .........................................................................74.........................................................133................................................ | Size | Perfect hit | Total Norm | Perfect Norm | SRR060983(GSM569187) Human pre-germinal center B cell [09-001]. (cell line) | SRR033716(GSM497061) Mentle Cell Lymphoma (MCL114). (B cell) | SRR314796(SRX084354) "Total RNA, fractionated (15-30nt)". (cell line) | SRR033713(GSM497058) Burkitt Lymphoma (BL115). (B cell) | SRR060986(GSM569190) Human memory B cell [09-001]. (cell line) | SRR343334 | SRR060981(GSM569185) Human centroblast [09-001]. (cell line) | SRR326280(GSM769510) total cell content of unperturbed cells was s. (cell line) | SRR033723(GSM497068) L1236 cell line (L1236). (B cell) | SRR033722(GSM497067) KMS12 cell line (KMS12). (B cell) | SRR033720(GSM497065) EBV activated B cell line (EBV159). (B cell) | SRR033727(GSM497072) HIV-positive DL (HIV412). (B cell) | SRR039636(GSM518473) THP1_cyto_sRNAs. (cell line) | SRR033719(GSM497064) 6hr Activated B cell line (ABC158). (B cell) | SRR033717(GSM497062) Mentle Cell Lymphoma (MCL112). (B cell) | SRR033721(GSM497066) Ly3 cell line (Ly3). (B cell) | SRR060985(GSM569189) Human naive B cell [09-001]. (cell line) | SRR060982(GSM569186) Human centrocyte [09-001]. (cell line) | SRR330916(SRX091754) tissue: normal skindisease state: normal. (skin) | RoviraIPAgo2(Rovira) total RNA. (ago2 breast) | SRR029054(GSM402329) MCF7_smallRNAseq. (cell line) | SRR039637(GSM518474) THP1_total_sRNAs. (cell line) | SRR038857(GSM458540) D20. (cell line) | SRR330877(SRX091715) tissue: skin psoriatic involveddisease state:. (skin) | DRR001489(DRX001043) "Hela short nuclear cell fraction, control". (hela) | SRR038858(GSM458541) MEL202. (cell line) | SRR039619(GSM531982) HBV(+) HCC Tissue Sample 1. (liver) | SRR033728(GSM497073) MALT (MALT413). (B cell) | SRR330906(SRX091744) tissue: normal skindisease state: normal. (skin) | SRR015364(GSM380329) Plasma B cells (PC44). (B cell) | SRR040043(GSM532928) G428T. (cervix) | SRR330889(SRX091727) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR207114(GSM721076) "IP against AGO 1 & 2, RRP40 knockdown". (ago1/2 RRP40 cell line) | SRR040029(GSM532914) G026T. (cervix) | SRR033730(GSM497075) Lymphoblastic (ALL411). (B cell) | SRR015446(SRR015446) smallRNAs high-throughput sequencing Total. (breast) | TAX577738(Rovira) total RNA. (breast) | SRR107296(GSM677703) 18-30nt fraction of small RNA. (cell line) | SRR039635(GSM518472) THP1_nuc_sRNAs. (cell line) | SRR191417(GSM715527) 39genomic small RNA (size selected RNA from t. (breast) | SRR326279(GSM769509) cytoplasmic fraction was isolated using PARIS. (cell line) | SRR191421(GSM715531) 122genomic small RNA (size selected RNA from . (breast) | GSM450608(GSM450608) miRNA sequencing raw reads from post-mortem s. (brain) | SRR039615(GSM531978) Severe Chronic Hepatitis B Liver Tissue. (liver) | SRR343335 | SRR189779(GSM714639) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | TAX577746(Rovira) total RNA. (breast) | SRR189784 | TAX577453(Rovira) total RNA. (breast) | SRR330913(SRX091751) tissue: normal skindisease state: normal. (skin) | SRR033724(GSM497069) L428 cell line (L428). (B cell) | SRR330919(SRX091757) tissue: normal skindisease state: normal. (skin) | SRR330896(SRX091734) tissue: skin psoriatic uninvolveddisease stat. (skin) | SRR039623(GSM531986) HCV(+) HCC Tissue Sample. (liver) | SRR189781(GSM714641) cell line: HEK293clip variant: PAR-CLIPenzyma. (cell line) | SRR330922(SRX091760) tissue: normal skindisease state: normal. (skin) | SRR330868(SRX091706) tissue: skin psoriatic involveddisease state:. (skin) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| .......................................................................................................................GCTTTCATCCCCAGACTGT............................................. | 19 | 1.00 | 0.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 1.00 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | |
| ...................................AACCACCTGCACCAGGT................................................................................................................................... | 17 | 2 | 0.50 | 0.50 | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | - | 0.50 | - | - |