ID:

hsa-mir-4447

Coordinate:

chr3:116850277-116850367 -

Confidence:

Known

Type:

Unknown

[View on miRBase]
[View on UCSC Genome Browser {Cornell Mirror}]

Legend:

mature

star

mismatch in alignment

mismatch in read

Predicted structure

No conservation details.

-29.6	-29.4	-29.4

mature

star

Sense Strand Reads

TTTATTCATCTGATTTTAATATTTCATTCCCATCCTCAGCTTTTTCTGGTGTTCTAGAGCATGGTTTCTCATCATTTGCACTACTGATACTTGGGGTCAGATAATTGTTTGTGGTGGGGGCTGTTGTTTGCATTGTAGGATGTTAGAAGAATCCTTCTTGGACTTCTACCCACTAGATGCCAGAAACACCC *********************************.....((((((((((((((((((((((((((((.((((((..(((.(((((((.......))))).))..)))..))))))))))))).)))))......)))))))))))))))).....*********************************	Read size	# Mismatch	Hit Count	Total Norm	Total	GSM450606 brain	GSM450601 brain	SRR139217 thymus	SRR553572 frontal-cortex	SRR039611 liver	TAX577745 breast	SRR040008 cervix	TAX577739 breast	GSM450602 brain	GSM450608 brain	SRR037876 fibroblast	TAX577738 breast	GSM450600 brain	TAX577579 breast	GSM450609 brain	TAX577453 breast	GSM450607 brain	SRR095854 brain	TAX577742 breast
......................................................................................................................................................ATCCTTCTTGGACTTCTA.......................	18	0	2	1.00	2	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
....................................................................................................................................TTGTAGGATGTTAGAAGA.........................................	18	0	1	1.00	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
..........................................................................TTTGCAATACTGATACTTGGGGTCA............................................................................................	25	1	1	1.00	1	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
.................................................................................................................................GCATTGTAGGATGTTAGAATAATC......................................	24	1	1	1.00	1	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
................................................................................................................GGTGGGGGCTGTTGTTT..............................................................	17	0	2	0.50	1	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0
.............................................................................................................TGTAGTGGGGGCTGTTGTT...............................................................	19	1	2	0.50	1	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0
...................................................................................................................GGGGGCTGTTGTTTGGATGGT.......................................................	21	2	3	0.33	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
...................................................................................................................GGGGGCTGTTGGTTGTATTGT.......................................................	21	2	3	0.33	1	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0
................................................................................................TCAGATAATAGTTTGTGGTGGT.........................................................................	22	2	4	0.25	1	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0
...................................................................................................................TGGGGCTGTAGTTTGCATTGT.......................................................	21	2	5	0.20	1	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0
................................................................................................TGAGGTAATTGTTTGCGGTGGG.........................................................................	22	3	11	0.18	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	1	0	0	0
...........................................................................................TAGGATCAGATAATTGTTTGTG..............................................................................	22	2	7	0.14	1	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0
...........................................................................................TGGGGTCACATAATGGTTTGTGT.............................................................................	23	3	8	0.13	1	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0
................................................................................................................GGTGGGGGCTGTTGTTTT.............................................................	18	1	18	0.11	2	0	0	0	0	0	0	0	0	0	0	1	0	0	1	0	0	0	0	0
................................................................................................TGAGGTAATTGTTTGTGGTGGGT........................................................................	23	3	9	0.11	1	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0
................................................................................................TAAGGTAGTTGTTTGTGGTGGG.........................................................................	22	3	14	0.07	1	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0
................................................................................................TAAGGTAATTGTTTGTGGAGGG.........................................................................	22	3	15	0.07	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0
................................................................................................................GGTGGGGTCTGTTGTTT..............................................................	17	1	17	0.06	1	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0
...................................................................................................................GGGGGCAGTTGTTTGCATAGTT......................................................	22	3	19	0.05	1	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0
......................................................................................................AATTGTTTGCGGTGGGGGGGGT...................................................................	22	3	19	0.05	1	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0
........................................................................................................................CTGTTGTTTGAAGTGTAGGA...................................................	20	2	20	0.05	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0
..............................................................................................................GTGGCGGAGGCTGTTGTTT..............................................................	19	2	20	0.05	1	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0
...................................................................................................................GGAGGGTGTTGTTTGTATTGTA......................................................	22	3	20	0.05	1	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0
...................................................................................................................GGGGGCTGTTGATTGGATTGTT......................................................	22	3	20	0.05	1	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
...................................................................................................................GGGGGCTGTAGATTGCATTGTT......................................................	22	3	20	0.05	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1

Anti-sense strand reads

AAATAAGTAGACTAAAATTATAAAGTAAGGGTAGGAGTCGAAAAAGACCACAAGATCTCGTACCAAAGAGTAGTAAACGTGATGACTATGAACCCCAGTCTATTAACAAACACCACCCCCGACAACAAACGTAACATCCTACAATCTTCTTAGGAAGAACCTGAAGATGGGTGATCTACGGTCTTTGTGGG *********************************.....((((((((((((((((((((((((((((.((((((..(((.(((((((.......))))).))..)))..))))))))))))).)))))......)))))))))))))))).....*********************************	Read size	# Mismatch	Hit Count	Total Norm	Total	SRR342899 heart	SRR444048 skin	SRR330915 skin	SRR342897 heart	TAX577740 breast
....................................................................AGTCGTAAGCGTGAAGACTATG.....................................................................................................	22	3	12	0.17	2	0	0	1	1	0
..............................................................CCAAAGAGTAGTAAA..................................................................................................................	15	0	20	0.15	3	3	0	0	0	0
........................................................................GTAAGCGTGAAGACTATG.....................................................................................................	18	2	20	0.10	2	0	2	0	0	0
.........................................................................................................................................................................GGTGATCTGCGGCCTTTG....	18	2	20	0.05	1	0	0	0	0	1

Re-alignment of all predicted orthologs

Species	Coordinate	ID	Alignment
hg38	chr3:116850227-116850417 -	hsa-mir-4447	TTTtTTgtTgTGtTTTTttTtTTTgtTTgggtTggTgtGgTTTTTgTGGTGTTgTtGtGgtTGGTTTgTgtTgtTTTGgtgTtgTGtTtgT------TGGGGTgtGtTttTTGTTTGTGGTGGGGGgTGTTGTTTGgtTTGTtGGtTGTTtGttGttTggTTgTTGGtgTTgTtgggtgTtGtTGggtGtttgtggg
panTro4	chr3:120208104-120208294 -		gTTtgTgGTgTGtTTTTtGTtTTTgtTTgggtTggTgtGgTTTTTgTGGTGTTgTtGtGgtTGGTTTgTgtTgtTTTGgtgTtgTGtTtgT------TGGGGTgtGtTttTTGTTTGTGGTGGGGGgTGTTGTTTGgtTTGTtGGtTGTTtGttGttTggTTgTTGGtgTTgTtgggtgTtGtTGggtGtttgtggg
rheMac3	chr2:36934942-36935132 -		gTTtTTgTTgTGtTTTTtGTtTTTgtTTgggtTggTgtGgTTTTTgTGGTGTTgTAGAGgtTGGTTTgTgtTgGTTTGgtgTtgTGtTtTT------TGGGGTgtGtTttTTGTTTGTGGTGGGGGgTGTTGTTTGgtTTGTtGGtTGTTtGttGttTgggTgTTTGtgTTgTttggtgTtGtTGggtGtttgtggg
mm10	chr16:41144588-41144767 +		TGGATTCTGGCCTTAACACTTAGTTGTCAGGTT-TTTTTTTTTTTCTGGTGTGCTAGAACATACTTAG----------ATCCTATATTACTAGTGTTTGA--CATTAATAATTCTTGTCACAACAACTGATCTCTGCATCAGATGGTATCAGGACAAT---ATTTACCCATTTTTAAT-GGGTTCATGTCAACACCT
rn5	Unknown		-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
canFam3	chr33:20837709-20837894 -		TTttTTgTTgTGtgTTtG--TTgTgTgTgggtggTTgtGgTTTTTgTGtTtTggTtgTGgtGGGTTTgTgtGTTTgTGggTTtTTGtTGgTT-----tGGGtTgtGtTttTtgTTTGTTGTTTtGGggtTggTtTGttTTGTttGtTtTTtGgtGgtTgggT----GtggTgTtgggtgTtGtgtTgtGTttgtgTt
monDom5	Unknown		-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

Re-alignment of all predicted orthologs with sRNA reads

Species

Read alignment

hg38

TTTtTTgtTgTGtTTTTttTtTTTgtTTgggtTggTgtGgTTTTTgTGGTGTTgTtGtGgtTGGTTTgTgtTgtTTTGgtgTtgTGtTtgT------TGGGGTgtGtTttTTGTTTGTGGTGGGGGgTGTTGTTTGgtTTGTtGGtTGTTtGttGttTggTTgTTGGtgTTgTtgggtgTtGtTGggtGtttgtggg	Size	Hit Count	Total Norm	Total	SRR039190 blood	SRR039191 blood	GSM450597 brain	GSM450598 brain	GSM450599 brain	GSM450600 brain	GSM450601 brain	GSM450602 brain	GSM450603 brain	GSM450604 brain	GSM450605 brain	GSM450606 brain	GSM450607 brain	GSM450608 brain	GSM450609 brain	GSM450610 brain	SRR095854 brain	SRR139162 brain	SRR139168 brain	RoviraIPAgo2 breast	SRR015446 breast	SRR015447 breast	SRR015448 breast	SRR191393 breast	SRR191394 breast	SRR191395 breast	SRR191396 breast	SRR191397 breast	SRR191398 breast	SRR191399 breast	SRR191400 breast	SRR191401 breast	SRR191402 breast	SRR191403 breast	SRR191404 breast	SRR191405 breast	SRR191406 breast	SRR191407 breast	SRR191408 breast	SRR191409 breast	SRR191410 breast	SRR191411 breast	SRR191412 breast	SRR191413 breast	SRR191414 breast	SRR191415 breast	SRR191416 breast	SRR191417 breast	SRR191418 breast	SRR191419 breast	SRR191420 breast	SRR191421 breast	SRR191422 breast	SRR191423 breast	SRR191424 breast	SRR191425 breast	SRR191426 breast	SRR191427 breast	SRR191428 breast	SRR191429 breast	SRR191430 breast	SRR191431 breast	SRR191432 breast	SRR191433 breast	SRR191434 breast	SRR191435 breast	SRR191436 breast	SRR191437 breast	SRR191438 breast	SRR191439 breast	SRR191440 breast	SRR191441 breast	SRR191442 breast	SRR191443 breast	SRR191444 breast	SRR191445 breast	SRR191446 breast	SRR191447 breast	SRR191448 breast	SRR191449 breast	SRR191450 breast	SRR191451 breast	SRR191452 breast	SRR191453 breast	SRR191454 breast	SRR191455 breast	SRR191456 breast	SRR191457 breast	SRR191458 breast	SRR191459 breast	SRR191460 breast	SRR191461 breast	SRR191462 breast	SRR191463 breast	SRR191464 breast	SRR191465 breast	SRR191466 breast	SRR191467 breast	SRR191468 breast	SRR191469 breast	SRR191470 breast	SRR191471 breast	SRR191472 breast	SRR191473 breast	SRR191474 breast	SRR191475 breast	SRR191476 breast	SRR191477 breast	SRR191478 breast	SRR191479 breast	SRR191480 breast	SRR191481 breast	SRR191482 breast	SRR191483 breast	SRR191484 breast	SRR191485 breast	SRR191486 breast	SRR191487 breast	SRR191488 breast	SRR191489 breast	SRR191490 breast	SRR191491 breast	SRR191492 breast	SRR191493 breast	SRR191494 breast	SRR191495 breast	SRR191496 breast	SRR191497 breast	SRR191498 breast	SRR191499 breast	SRR191500 breast	SRR191501 breast	SRR191502 breast	SRR191503 breast	SRR191504 breast	SRR191505 breast	SRR191506 breast	SRR191507 breast	SRR191508 breast	SRR191509 breast	SRR191510 breast	SRR191511 breast	SRR191512 breast	SRR191513 breast	SRR191514 breast	SRR191515 breast	SRR191516 breast	SRR191517 breast	SRR191518 breast	SRR191519 breast	SRR191520 breast	SRR191521 breast	SRR191522 breast	SRR191523 breast	SRR191524 breast	SRR191525 breast	SRR191526 breast	SRR191527 breast	SRR191528 breast	SRR191529 breast	SRR191530 breast	SRR191531 breast	SRR191532 breast	SRR191533 breast	SRR191534 breast	SRR191535 breast	SRR191536 breast	SRR191537 breast	SRR191538 breast	SRR191539 breast	SRR191540 breast	SRR191541 breast	SRR191542 breast	SRR191543 breast	SRR191544 breast	SRR191545 breast	SRR191546 breast	SRR191547 breast	SRR191548 breast	SRR191549 breast	SRR191550 breast	SRR191551 breast	SRR191552 breast	SRR191553 breast	SRR191554 breast	SRR191555 breast	SRR191556 breast	SRR191557 breast	SRR191558 breast	SRR191559 breast	SRR191560 breast	SRR191561 breast	SRR191562 breast	SRR191563 breast	SRR191564 breast	SRR191565 breast	SRR191566 breast	SRR191567 breast	SRR191568 breast	SRR191569 breast	SRR191570 breast	SRR191571 breast	SRR191572 breast	SRR191573 breast	SRR191574 breast	SRR191575 breast	SRR191576 breast	SRR191577 breast	SRR191578 breast	SRR191579 breast	SRR191580 breast	SRR191581 breast	SRR191582 breast	SRR191583 breast	SRR191584 breast	SRR191585 breast	SRR191586 breast	SRR191587 breast	SRR191588 breast	SRR191589 breast	SRR191590 breast	SRR191591 breast	SRR191592 breast	SRR191593 breast	SRR191594 breast	SRR191595 breast	SRR191596 breast	SRR191597 breast	SRR191598 breast	SRR191599 breast	SRR191600 breast	SRR191601 breast	SRR191602 breast	SRR191603 breast	SRR191604 breast	SRR191605 breast	SRR191606 breast	SRR191607 breast	SRR191608 breast	SRR191609 breast	SRR191610 breast	SRR191611 breast	SRR191612 breast	SRR191613 breast	SRR191614 breast	SRR191615 breast	SRR191616 breast	SRR191617 breast	SRR191618 breast	SRR191619 breast	SRR191620 breast	SRR191621 breast	SRR191622 breast	SRR191623 breast	SRR191624 breast	SRR191625 breast	SRR191626 breast	SRR191627 breast	SRR191628 breast	SRR191629 breast	SRR191630 breast	SRR191631 breast	SRR191632 breast	SRR191633 breast	SRR191634 breast	SRR191635 breast	SRR191636 breast	SRR191637 breast	TAX577453 breast	TAX577579 breast	TAX577580 breast	TAX577588 breast	TAX577589 breast	TAX577590 breast	TAX577738 breast	TAX577739 breast	TAX577740 breast	TAX577741 breast	TAX577742 breast	TAX577743 breast	TAX577744 breast	TAX577745 breast	TAX577746 breast	SRR553573 cerebellum	GSM532871 cervix	GSM532873 cervix	GSM532875 cervix	GSM532877 cervix	GSM532879 cervix	GSM532881 cervix	GSM532883 cervix	GSM532885 cervix	GSM532887 cervix	GSM532889 cervix	GSM532929 cervix	SRR040006 cervix	SRR040008 cervix	SRR040010 cervix	SRR040012 cervix	SRR040014 cervix	SRR040016 cervix	SRR040018 cervix	SRR040020 cervix	SRR040022 cervix	SRR040024 cervix	SRR040026 cervix	SRR040028 cervix	SRR040030 cervix	SRR040032 cervix	SRR040034 cervix	SRR040036 cervix	SRR040038 cervix	SRR040040 cervix	SRR040042 cervix	SRR037876 fibroblast	SRR363673 fibroblast	SRR363674 fibroblast	SRR363675 fibroblast	SRR363676 fibroblast	SRR553572 frontal-cortex	SRR139164 heart	SRR139165 heart	SRR139166 heart	SRR139167 heart	SRR139169 heart	SRR139170 heart	SRR342894 heart	SRR342895 heart	SRR342896 heart	SRR342897 heart	SRR342898 heart	SRR342899 heart	SRR342900 heart	SRR342901 heart	SRR553574 heart	SRR139171 kidney	SRR139172 kidney	SRR139173 kidney	SRR139174 kidney	SRR139175 kidney	SRR139176 kidney	SRR553575 Kidney	SRR039611 liver	SRR039612 liver	SRR039613 liver	SRR039614 liver	SRR039615 liver	SRR039616 liver	SRR039617 liver	SRR039618 liver	SRR039619 liver	SRR039620 liver	SRR039621 liver	SRR039622 liver	SRR039623 liver	SRR039624 liver	SRR039625 liver	SRR139177 liver	SRR139178 liver	SRR139179 liver	SRR139180 liver	SRR139181 liver	SRR139182 liver	SRR139183 lung	SRR139184 lung	SRR139185 lung	SRR139186 lung	SRR139187 lung	SRR139188 lung	SRR139189 lung	SRR139190 lung	GSM379266 ovary	SRR139191 ovary	SRR139192 ovary	SRR139193 ovary	SRR139194 ovary	SRR139195 ovary	SRR139196 ovary	SRR139197 ovary	SRR139198 placenta	SRR139199 placenta	SRR139200 placenta	SRR139201 placenta	SRR330904 skin	SRR330905 skin	SRR330906 skin	SRR330907 skin	SRR330908 skin	SRR330909 skin	SRR330910 skin	SRR330911 skin	SRR330912 skin	SRR330913 skin	SRR330914 skin	SRR330915 skin	SRR330916 skin	SRR330917 skin	SRR330918 skin	SRR330919 skin	SRR330920 skin	SRR330921 skin	SRR330922 skin	SRR330923 skin	SRR444043 skin	SRR444045 skin	SRR444048 skin	SRR444050 skin	SRR444051 skin	SRR444060 skin	SRR444061 skin	SRR139202 spleen	SRR139203 spleen	SRR139204 spleen	SRR139205 spleen	SRR139206 spleen	SRR139207 spleen	SRR139208 testes	SRR139209 testes	SRR139210 testes	SRR139211 testes	SRR139212 testes	SRR139213 testes	SRR553576 testes	SRR139214 thymus	SRR139215 thymus	SRR139216 thymus	SRR139217 thymus	SRR139218 thymus	SRR139219 thymus	SRR094129 uterus	SRR094130 uterus	SRR094131 uterus	SRR094132 uterus
............................................................................................................................................................ATCCTTCTTGGACTTCTA.......................	18	2	1.00	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0
..........................................................................................................................................TTGTAGGATGTTAGAAGA.........................................	18	1	1.00	1	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
......................................................................................................................GGTGGGGGCTGTTGTTT..............................................................	17	2	0.50	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
......................................................................................................................GGTGGGGGCTGTTGTTTT.............................................................	18	18	0.11	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0

panTro4

gTTtgTgGTgTGtTTTTtGTtTTTgtTTgggtTggTgtGgTTTTTgTGGTGTTgTtGtGgtTGGTTTgTgtTgtTTTGgtgTtgTGtTtgT------TGGGGTgtGtTttTTGTTTGTGGTGGGGGgTGTTGTTTGgtTTGTtGGtTGTTtGttGttTggTTgTTGGtgTTgTtgggtgTtGtTGggtGtttgtggg	Size	Hit Count	Total Norm	Total
No Reads

rheMac3

gTTtTTgTTgTGtTTTTtGTtTTTgtTTgggtTggTgtGgTTTTTgTGGTGTTgTAGAGgtTGGTTTgTgtTgGTTTGgtgTtgTGtTtTT------TGGGGTgtGtTttTTGTTTGTGGTGGGGGgTGTTGTTTGgtTTGTtGGtTGTTtGttGttTgggTgTTTGtgTTgTttggtgTtGtTGggtGtttgtggg	Size	Hit Count	Total Norm	Total
No Reads

mm10

TGGATTCTGGCCTTAACACTTAGTTGTCAGGTT-TTTTTTTTTTTCTGGTGTGCTAGAACATACTTAG----------ATCCTATATTACTAGTGTTTGA--CATTAATAATTCTTGTCACAACAACTGATCTCTGCATCAGATGGTATCAGGACAAT---ATTTACCCATTTTTAAT-GGGTTCATGTCAACACCT	Size	Hit Count	Total Norm	Total	SRR042455 blood	SRR042459 blood	SRR042460 blood	SRR069834 blood	SRR073954 blood	SRR073955 blood	SRR525238 Blood	SRR525237 Blood	SRR042456 bone marrow	SRR042457 bone marrow	SRR042461 bone marrow	SRR042462 bone marrow	GSM317181 brain	GSM317182 brain	GSM361394 brain	GSM361395 brain	GSM361398 brain	GSM361399 brain	GSM361402 brain	GSM361407 brain	GSM361408 brain	GSM361415 brain	GSM361430 brain	GSM510444 brain	SRR037904 brain	SRR037905 brain	SRR037906 brain	SRR037907 brain	SRR038741 brain	SRR038744 brain	SRR039610 brain	SRR042477 brain	SRR060845 brain	SRR206939 brain	SRR206940 brain	SRR206941 brain	SRR206942 brain	SRR345196 brain	SRR345197 brain	SRR345198 brain	SRR345199 brain	SRR345200 brain	SRR345201 brain	SRR345202 brain	SRR345203 brain	SRR345204 brain	SRR345205 brain	SRR345206 brain	SRR345207 brain	SRR037919 embryo	SRR037920 embryo	SRR037921 embryo	SRR037922 embryo	SRR037923 embryo	SRR037924 embryo	SRR037925 embryo	SRR037926 embryo	SRR037927 embryo	SRR037928 embryo	SRR037929 embryo	SRR037930 embryo	SRR391845 embryo	SRR391846 embryo	SRR391847 embryo	SRR391848 embryo	SRR391849 embryo	SRR391850 embryo	SRR391851 embryo	SRR391852 embryo	SRR391853 embryo	SRR116846 epididymis	GSM566419 fibroblast	GSM566420 fibroblast	SRR039183 fibroblast	SRR039184 fibroblast	SRR039185 fibroblast	SRR039186 fibroblast	SRR042475 fibroblast	SRR390297 fibroblast	SRR390298 fibroblast	SRR042484 salivary gland	SRR042476 heart	SRR095853 heart	SRR095855BC1 heart	SRR095855BC10 heart	SRR095855BC2 heart	SRR095855BC3 heart	SRR095855BC4 heart	SRR095855BC5 heart	SRR095855BC6 heart	SRR095855BC7 heart	SRR095855BC8 heart	SRR095855BC9 heart	SRR065052 jejunum	SRR065053 jejunum	SRR065054 jejunum	SRR065055 jejunum	SRR065056 jejunum	SRR042480 kidney	SRR040488 liver	SRR042479 liver	SRR065045 liver	SRR065046 liver	SRR065047 liver	SRR065048 liver	SRR065049 liver	SRR065050 liver	SRR077864 liver	SRR077865 liver	SRR077866 liver	SRR042478 lung	SRR042468 lymph	SRR042469 lymph	SRR042470 lymph	SRR042472 lymph	SRR042473 lymph	SRR039152 muscle	SRR039153 muscle	SRR039154 muscle	SRR042483 muscle	SRR014234 ovary	SRR037896 ovary	SRR037897 ovary	SRR037898 ovary	SRR037899 ovary	SRR042486 ovary	SRR042481 pancreas	SRR065058 pancreas	SRR065059 pancreas	SRR042482 skin	SRR042463 spleen	SRR042465 spleen	SRR042466 spleen	SRR042467 spleen	SRR042471 spleen	SRR042487 spleen	SRR059768 spleen	SRR059769 spleen	SRR059770 spleen	SRR059771 spleen	SRR059772 spleen	SRR059773 spleen	GSM475281 testes	GSM509275 testes	GSM509279 testes	SRR014231 testes	SRR014235 testes	SRR014236 testes	SRR028731 testes	SRR037900 testes	SRR037901 testes	SRR037902 testes	SRR037903 testes	SRR042485 testes	SRR051939 testes	SRR051940 testes	SRR069809 testes	SRR069810 testes	SRR069811 testes	SRR248523 testes	SRR248524 testes	SRR248525 testes	SRR248526 testes	SRR248527 testes	SRR363956 testes	SRR363957 testes	SRR363958 testes	SRR363959 testes	SRR363960 testes	SRR363963 testes	SRR363964 testes	SRR042464 thymus	SRR059765 thymus	SRR059766 thymus	SRR059767 thymus	SRR032476 uterus	SRR032477 uterus
...................................................................................................................................................ATCAGGACAAT---ATTTACCCATTT........................	23	1	1.00	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0

rn5

-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------	Size	Hit Count	Total Norm	Total
No Reads

canFam3

TTttTTgTTgTGtgTTtG--TTgTgTgTgggtggTTgtGgTTTTTgTGtTtTggTtgTGgtGGGTTTgTgtGTTTgTGggTTtTTGtTGgTT-----tGGGtTgtGtTttTtgTTTGTTGTTTtGGggtTggTtTGttTTGTttGtTtTTtGgtGgtTgggT----GtggTgTtgggtgTtGtgtTgtGTttgtgTt	Size	Hit Count	Total Norm	Total
No Reads

monDom5

-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------	Size	Hit Count	Total Norm	Total
No Reads

Generated: 12/12/2014 at 11:24 AM