ID:

hsa-mir-3118-2

 Coordinate:

chr15:20832795-20832869 +

 Confidence:

Known

 Type:

Unknown

 [View on miRBase]
[View on UCSC Genome Browser {Cornell Mirror}]
Legend: mature star mismatch in alignment mismatch in read

Predicted structure

No conservation details.

-33.5
mature
  1. chr13:37396364-37396382 +
  2. chr14_GL000009v2_random:81366-81384 -
  3. has_334  chr15:20832810-20832828 +
  4. has_536  chr15:21406400-21406418 +
  5. has_549  chr15:21843765-21843783 +
  6. chr15_KI270727v1_random:133596-133614 +
  7. chr18:14508493-14508511 +
  8. chr1_KI270706v1_random:46003-46021 +
  9. chr20:30626943-30626961 +
  10. has_1532  chr21:13644816-13644834 -
  11. chr4:49209389-49209407 +
  12. chr4:49583066-49583084 -
  13. chr4_GL000008v2_random:131870-131888 +
  14. chr8:43366754-43366772 -
  15. chr8:47085367-47085385 +
  16. chr15_KI270852v1_alt:164347-164365 +
  17. chrUn_GL000213v1:104758-104776 +
  18. chrX:93010288-93010306 -
  19. chrY:6126538-6126556 -
star
  1. chr14_GL000009v2_random:81335-81356 -
  2. has_334  chr15:20832838-20832859 +
  3. has_536  chr15:21406428-21406449 +
  4. has_549  chr15:21843793-21843814 +
  5. chr15_KI270727v1_random:133624-133645 +
  6. chr1_KI270706v1_random:46031-46052 +
  7. has_1532  chr21:13644785-13644806 -
  8. chr4_GL000008v2_random:131898-131919 +
  9. chr15_KI270852v1_alt:164375-164396 +
  10. chrUn_GL000213v1:104786-104807 +
  11. chrUn_KI270743v1:116771-116792 +

Sense Strand Reads

GGACCCCAGCCTGGCCACATCTGCTTACAGGGCACTCTCAGGTGCCCACACATACTACAATAATTTTCATAATGCAATCACACACAATCACCGTGTGACTGCATTATGAAAATTCTTCTAGTGTGATTTACAGCTCTGTCAGGTCAGTTATTTTCTTCTTTATACTTGCTATTTT
**************************************************(((((((.((.(((((((((((((((.((((((.........)))))).))))))))))))))).)).))))))).....********************************************* 		Read size # Mismatch Hit Count Total Norm Total SRR039190
blood		 SRR139184
lung		 SRR139186
lung		 SRR039621
liver		 SRR139188
lung		 SRR039625
liver		 TAX577579
breast		 SRR191602
breast		 SRR342901
heart		 SRR039619
liver		 GSM450603
brain		 TAX577739
breast		 GSM450602
brain		 SRR191603
breast		 SRR330913
skin		 SRR342897
heart		 SRR094131
uterus		 TAX577745
breast		 GSM450601
brain		 SRR040012
cervix		 SRR191500
breast		 SRR191579
breast		 SRR330904
skin		 SRR363674
fibroblast		 TAX577589
breast		 TAX577741
breast		 SRR040034
cervix		 SRR330920
skin		 SRR330921
skin		 SRR342896
heart		 SRR342900
heart		 SRR553572
frontal-cortex		 TAX577744
breast
.................................................................TTCATAATGCAATCACACA........................................................................................... 19 0 19 4.00 76 0 38 38 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
.............................................................................................TGTGACTGCATTATGAAAATTC............................................................ 22 0 11 3.73 41 30 0 0 2 0 5 0 0 0 2 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
.............................................................................................TGTGACTGGATTATGAAAATT............................................................. 21 1 12 1.58 19 6 0 0 0 0 0 2 1 1 0 2 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 0 0 0 0 0 0 0
................ACATCTGCTTACAGGG............................................................................................................................................... 16 0 7 1.00 7 0 0 0 0 7 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
.............................................................................................TGTGACTGGATTATGAAAATTA............................................................ 22 2 20 0.95 19 5 0 0 0 0 0 1 1 2 0 0 0 0 2 2 1 0 0 0 0 0 0 0 0 0 0 0 1 0 1 1 1 1
.............................................................................................TGTGACTGCATTATGAAAATT............................................................. 21 0 11 0.73 8 1 0 0 6 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
.............................................................................................TGTGACTGCATTATGAAAATA............................................................. 21 1 13 0.15 2 0 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
.............................................................................................TGTGACTGCATTATGAAAATTT............................................................ 22 1 13 0.15 2 1 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
............GGCCACATCTGCTTACAGTGCT............................................................................................................................................. 22 2 9 0.11 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
...............................................................................................TGACGGCATTATGAAAATTCT........................................................... 21 1 11 0.09 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
..............................................................................................GTGACTGCATTATGAAAATT............................................................. 20 0 11 0.09 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
.............................................................................................TGTGACTGCATTATGAAAAT.............................................................. 20 0 11 0.09 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
.............................................................................................TGTGACTGTATTATGAAAATT............................................................. 21 1 12 0.08 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
.............................................................................................TATGACTGCATTATGAAAATT............................................................. 21 1 12 0.08 1 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
.............................................................................................TGTGACTGCATTAGGAAAAT.............................................................. 20 1 12 0.08 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
............................................................................................TTGTGACTGCATTATGAAAATTC............................................................ 23 1 12 0.08 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0
.............................................................................................TGTGACTGGATTATGCAAATT............................................................. 21 2 17 0.06 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
.............................................................................................GGTGACTGGATTATGAAAATT............................................................. 21 2 19 0.05 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0
........................................................................................CACCGTGTGACTG.......................................................................... 13 0 20 0.05 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0
..................................................................................................................................................GTTATTTTCTT.................. 11 0 20 0.05 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
.............................................................................................TGTGACTGCATTATGAAAATTA............................................................ 22 1 20 0.05 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
.............................................................................................AGTGAGTGCATTATGAAAATT............................................................. 21 2 20 0.05 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
.............................................................................................TGTGACTGGCTTATGAAAATT............................................................. 21 2 20 0.05 1 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
...............................................................................................TGACTGGATTATGAAAATTATT.......................................................... 22 2 20 0.05 1 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

Anti-sense strand reads

CCTGGGGTCGGACCGGTGTAGACGAATGTCCCGTGAGAGTCCACGGGTGTGTATGATGTTATTAAAAGTATTACGTTAGTGTGTGTTAGTGGCACACTGACGTAATACTTTTAAGAAGATCACACTAAATGTCGAGACAGTCCAGTCAATAAAAGAAGAAATATGAACGATAAAA
*********************************************(((((((.((.(((((((((((((((.((((((.........)))))).))))))))))))))).)).))))))).....************************************************** 		Read size # Mismatch Hit Count Total Norm Total SRR139211
testes		 SRR139209
testes		 SRR139164
heart		 SRR139166
heart		 SRR139193
ovary		 SRR139202
spleen		 SRR139203
spleen		 SRR139208
testes		 SRR039190
blood		 SRR039621
liver		 TAX577738
breast		 SRR191602
breast		 SRR039191
blood		 SRR553576
testes		 TAX577579
breast		 SRR191603
breast		 SRR330913
skin		 SRR342901
heart		 SRR039624
liver		 TAX577745
breast		 SRR039620
liver		 SRR342898
heart		 SRR094129
uterus		 SRR191420
breast		 SRR330920
skin		 SRR342896
heart		 SRR342900
heart		 SRR553572
frontal-cortex		 TAX577739
breast		 TAX577744
breast
.............................................................TTAAAAGTATTACGTTAGTGT............................................................................................. 21 0 14 3.57 50 0 0 14 14 0 0 14 0 2 0 1 0 2 0 1 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0
....................................................................................................................................CGAGACAGTCCAGTCAATAAAAGAAGAAAT............. 30 0 8 2.13 17 8 8 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
............................................................ATTAAAAGTATTACGTTAGTGT............................................................................................. 22 0 11 1.55 17 0 0 0 0 0 11 0 0 1 2 1 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0
.................................................................................................................AGAAGATCACACTAAATGTCGAGACAGT.................................. 28 0 8 1.00 8 0 0 0 0 0 0 0 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
.....................................................................................................GTAATACTTTTAAGAAGATCACACT................................................. 25 0 8 1.00 8 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
............................................................................................................................................TCCAGTCAATAAAAGAAGAAATATGAAC....... 28 0 7 1.00 7 7 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
................................................................................................CTGACGTAATACTTTTAAGAAGATCACACT................................................. 30 0 7 1.00 7 0 7 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
............................................................ATTAAAAGTATTACGTTAGT............................................................................................... 20 0 11 1.00 11 0 0 0 0 11 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
....................................................................................................................................CGAGACAGTCCAGTCAATAA....................... 20 0 8 1.00 8 0 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
...........................................................................................................................ACTAAATGTCGAGACAGTCCAGTCAAT......................... 27 0 8 1.00 8 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
............................................................ATTAAAAGTATTAGGTCAGTGT............................................................................................. 22 2 20 0.90 18 0 0 0 0 0 0 0 0 5 0 0 1 0 0 1 2 2 2 0 0 0 0 0 0 1 1 1 1 0 1
............................................................ATTAAAAGTGTTACGTTAGTGT............................................................................................. 22 1 11 0.09 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
...............................................................................................ACTGACGTAATACTTTTAAGA........................................................... 21 0 11 0.09 1 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
.............................................................................................ACACTGCCGTAATACTTTTA.............................................................. 20 1 11 0.09 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0
..............................................................TAAAAGTATTACGTTAGTGT............................................................................................. 20 0 14 0.07 1 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
...................................AGAGTCGACAGGTGTGTATG........................................................................................................................ 20 2 20 0.05 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0
............................................................ATTAAAAGTATTACGTCAGTGT............................................................................................. 22 1 20 0.05 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
...............................................................................................................................................TGTCAATAAAAGAAGAAATAG........... 21 2 20 0.05 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0
..........................................................TTATTAAAAGTATTAGGTCAGT............................................................................................... 22 2 20 0.05 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
.............................................................TTAAAAGTATTACGTGAGTGA............................................................................................. 21 2 20 0.05 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0

Re-alignment of all predicted orthologs

Species Coordinate ID Alignment
hg38 chr15:20832745-20832919 + hsa-mir-3118-2 ggaccccagcctggccacatctgcttacagggcactctcaggtgcccacacatactacaataattttcataatgcaatcacacacaatcaccgtgtgactgcattatgaaaattcttctagtgtgatttacagctctgtcaggtcagttattttcttctttatacttgctatttt
panTro4 chrUn_GL393519:4183-4357 + ggaccccagcctggccacacctgcttacagggcactctcaggtgcccacacatactacaataattttcataatgcaatcacacacaatcaccatgtgactgcattatgaaaattcttctagtgtgatttacagctctgtcaggtcagttattttcttctgtatactcgctatttt
rheMac3 Unknown -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
mm10 Unknown -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
rn5 Unknown -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
canFam3 Unknown -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
monDom5 Unknown -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

Re-alignment of all predicted orthologs with sRNA reads

Species Read alignment
hg38
ggaccccagcctggccacatctgcttacagggcactctcaggtgcccacacatactacaataattttcataatgcaatcacacacaatcaccgtgtgactgcattatgaaaattcttctagtgtgatttacagctctgtcaggtcagttattttcttctttatacttgctattttSizeHit CountTotal NormTotalSRR039190
blood		SRR039191
blood		GSM450597
brain		GSM450598
brain		GSM450599
brain		GSM450600
brain		GSM450601
brain		GSM450602
brain		GSM450603
brain		GSM450604
brain		GSM450605
brain		GSM450606
brain		GSM450607
brain		GSM450608
brain		GSM450609
brain		GSM450610
brain		SRR095854
brain		SRR139162
brain		SRR139168
brain		RoviraIPAgo2
breast		SRR015446
breast		SRR015447
breast		SRR015448
breast		SRR191393
breast		SRR191394
breast		SRR191395
breast		SRR191396
breast		SRR191397
breast		SRR191398
breast		SRR191399
breast		SRR191400
breast		SRR191401
breast		SRR191402
breast		SRR191403
breast		SRR191404
breast		SRR191405
breast		SRR191406
breast		SRR191407
breast		SRR191408
breast		SRR191409
breast		SRR191410
breast		SRR191411
breast		SRR191412
breast		SRR191413
breast		SRR191414
breast		SRR191415
breast		SRR191416
breast		SRR191417
breast		SRR191418
breast		SRR191419
breast		SRR191420
breast		SRR191421
breast		SRR191422
breast		SRR191423
breast		SRR191424
breast		SRR191425
breast		SRR191426
breast		SRR191427
breast		SRR191428
breast		SRR191429
breast		SRR191430
breast		SRR191431
breast		SRR191432
breast		SRR191433
breast		SRR191434
breast		SRR191435
breast		SRR191436
breast		SRR191437
breast		SRR191438
breast		SRR191439
breast		SRR191440
breast		SRR191441
breast		SRR191442
breast		SRR191443
breast		SRR191444
breast		SRR191445
breast		SRR191446
breast		SRR191447
breast		SRR191448
breast		SRR191449
breast		SRR191450
breast		SRR191451
breast		SRR191452
breast		SRR191453
breast		SRR191454
breast		SRR191455
breast		SRR191456
breast		SRR191457
breast		SRR191458
breast		SRR191459
breast		SRR191460
breast		SRR191461
breast		SRR191462
breast		SRR191463
breast		SRR191464
breast		SRR191465
breast		SRR191466
breast		SRR191467
breast		SRR191468
breast		SRR191469
breast		SRR191470
breast		SRR191471
breast		SRR191472
breast		SRR191473
breast		SRR191474
breast		SRR191475
breast		SRR191476
breast		SRR191477
breast		SRR191478
breast		SRR191479
breast		SRR191480
breast		SRR191481
breast		SRR191482
breast		SRR191483
breast		SRR191484
breast		SRR191485
breast		SRR191486
breast		SRR191487
breast		SRR191488
breast		SRR191489
breast		SRR191490
breast		SRR191491
breast		SRR191492
breast		SRR191493
breast		SRR191494
breast		SRR191495
breast		SRR191496
breast		SRR191497
breast		SRR191498
breast		SRR191499
breast		SRR191500
breast		SRR191501
breast		SRR191502
breast		SRR191503
breast		SRR191504
breast		SRR191505
breast		SRR191506
breast		SRR191507
breast		SRR191508
breast		SRR191509
breast		SRR191510
breast		SRR191511
breast		SRR191512
breast		SRR191513
breast		SRR191514
breast		SRR191515
breast		SRR191516
breast		SRR191517
breast		SRR191518
breast		SRR191519
breast		SRR191520
breast		SRR191521
breast		SRR191522
breast		SRR191523
breast		SRR191524
breast		SRR191525
breast		SRR191526
breast		SRR191527
breast		SRR191528
breast		SRR191529
breast		SRR191530
breast		SRR191531
breast		SRR191532
breast		SRR191533
breast		SRR191534
breast		SRR191535
breast		SRR191536
breast		SRR191537
breast		SRR191538
breast		SRR191539
breast		SRR191540
breast		SRR191541
breast		SRR191542
breast		SRR191543
breast		SRR191544
breast		SRR191545
breast		SRR191546
breast		SRR191547
breast		SRR191548
breast		SRR191549
breast		SRR191550
breast		SRR191551
breast		SRR191552
breast		SRR191553
breast		SRR191554
breast		SRR191555
breast		SRR191556
breast		SRR191557
breast		SRR191558
breast		SRR191559
breast		SRR191560
breast		SRR191561
breast		SRR191562
breast		SRR191563
breast		SRR191564
breast		SRR191565
breast		SRR191566
breast		SRR191567
breast		SRR191568
breast		SRR191569
breast		SRR191570
breast		SRR191571
breast		SRR191572
breast		SRR191573
breast		SRR191574
breast		SRR191575
breast		SRR191576
breast		SRR191577
breast		SRR191578
breast		SRR191579
breast		SRR191580
breast		SRR191581
breast		SRR191582
breast		SRR191583
breast		SRR191584
breast		SRR191585
breast		SRR191586
breast		SRR191587
breast		SRR191588
breast		SRR191589
breast		SRR191590
breast		SRR191591
breast		SRR191592
breast		SRR191593
breast		SRR191594
breast		SRR191595
breast		SRR191596
breast		SRR191597
breast		SRR191598
breast		SRR191599
breast		SRR191600
breast		SRR191601
breast		SRR191602
breast		SRR191603
breast		SRR191604
breast		SRR191605
breast		SRR191606
breast		SRR191607
breast		SRR191608
breast		SRR191609
breast		SRR191610
breast		SRR191611
breast		SRR191612
breast		SRR191613
breast		SRR191614
breast		SRR191615
breast		SRR191616
breast		SRR191617
breast		SRR191618
breast		SRR191619
breast		SRR191620
breast		SRR191621
breast		SRR191622
breast		SRR191623
breast		SRR191624
breast		SRR191625
breast		SRR191626
breast		SRR191627
breast		SRR191628
breast		SRR191629
breast		SRR191630
breast		SRR191631
breast		SRR191632
breast		SRR191633
breast		SRR191634
breast		SRR191635
breast		SRR191636
breast		SRR191637
breast		TAX577453
breast		TAX577579
breast		TAX577580
breast		TAX577588
breast		TAX577589
breast		TAX577590
breast		TAX577738
breast		TAX577739
breast		TAX577740
breast		TAX577741
breast		TAX577742
breast		TAX577743
breast		TAX577744
breast		TAX577745
breast		TAX577746
breast		SRR553573
cerebellum		GSM532871
cervix		GSM532873
cervix		GSM532875
cervix		GSM532877
cervix		GSM532879
cervix		GSM532881
cervix		GSM532883
cervix		GSM532885
cervix		GSM532887
cervix		GSM532889
cervix		GSM532929
cervix		SRR040006
cervix		SRR040008
cervix		SRR040010
cervix		SRR040012
cervix		SRR040014
cervix		SRR040016
cervix		SRR040018
cervix		SRR040020
cervix		SRR040022
cervix		SRR040024
cervix		SRR040026
cervix		SRR040028
cervix		SRR040030
cervix		SRR040032
cervix		SRR040034
cervix		SRR040036
cervix		SRR040038
cervix		SRR040040
cervix		SRR040042
cervix		SRR037876
fibroblast		SRR363673
fibroblast		SRR363674
fibroblast		SRR363675
fibroblast		SRR363676
fibroblast		SRR553572
frontal-cortex		SRR139164
heart		SRR139165
heart		SRR139166
heart		SRR139167
heart		SRR139169
heart		SRR139170
heart		SRR342894
heart		SRR342895
heart		SRR342896
heart		SRR342897
heart		SRR342898
heart		SRR342899
heart		SRR342900
heart		SRR342901
heart		SRR553574
heart		SRR139171
kidney		SRR139172
kidney		SRR139173
kidney		SRR139174
kidney		SRR139175
kidney		SRR139176
kidney		SRR553575
Kidney		SRR039611
liver		SRR039612
liver		SRR039613
liver		SRR039614
liver		SRR039615
liver		SRR039616
liver		SRR039617
liver		SRR039618
liver		SRR039619
liver		SRR039620
liver		SRR039621
liver		SRR039622
liver		SRR039623
liver		SRR039624
liver		SRR039625
liver		SRR139177
liver		SRR139178
liver		SRR139179
liver		SRR139180
liver		SRR139181
liver		SRR139182
liver		SRR139183
lung		SRR139184
lung		SRR139185
lung		SRR139186
lung		SRR139187
lung		SRR139188
lung		SRR139189
lung		SRR139190
lung		GSM379266
ovary		SRR139191
ovary		SRR139192
ovary		SRR139193
ovary		SRR139194
ovary		SRR139195
ovary		SRR139196
ovary		SRR139197
ovary		SRR139198
placenta		SRR139199
placenta		SRR139200
placenta		SRR139201
placenta		SRR330904
skin		SRR330905
skin		SRR330906
skin		SRR330907
skin		SRR330908
skin		SRR330909
skin		SRR330910
skin		SRR330911
skin		SRR330912
skin		SRR330913
skin		SRR330914
skin		SRR330915
skin		SRR330916
skin		SRR330917
skin		SRR330918
skin		SRR330919
skin		SRR330920
skin		SRR330921
skin		SRR330922
skin		SRR330923
skin		SRR444043
skin		SRR444045
skin		SRR444048
skin		SRR444050
skin		SRR444051
skin		SRR444060
skin		SRR444061
skin		SRR139202
spleen		SRR139203
spleen		SRR139204
spleen		SRR139205
spleen		SRR139206
spleen		SRR139207
spleen		SRR139208
testes		SRR139209
testes		SRR139210
testes		SRR139211
testes		SRR139212
testes		SRR139213
testes		SRR553576
testes		SRR139214
thymus		SRR139215
thymus		SRR139216
thymus		SRR139217
thymus		SRR139218
thymus		SRR139219
thymus		SRR094129
uterus		SRR094130
uterus		SRR094131
uterus		SRR094132
uterus
.................................................................TTCATAATGCAATCACACA...........................................................................................19194.0076000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000038038000000000000000000000000000000000000000000000000000000000000000000
.............................................................................................TGTGACTGCATTATGAAAATTC............................................................22113.734130000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000010000010000000000000000000000000000000000000000000000000000000000000000000020200050000000000000000000000000000000000000000000000000000000000000000000000000000
................ACATCTGCTTACAGGG...............................................................................................................................................1671.0070000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000070000000000000000000000000000000000000000000000000000000000000000
.............................................................................................TGTGACTGCATTATGAAAATT.............................................................21110.7381000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000600000000000000000000000000000000000000000000000000000000000000000000000000000010
.............................................................................................TGTGACTGCATTATGAAAATA.............................................................21130.1520000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000200000000000000000000000000000000000000000000000000000000000000000000000000000000
.............................................................................................TGTGACTGCATTATGAAAATTT............................................................22130.1521000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000
..............................................................................................GTGACTGCATTATGAAAATT.............................................................20110.0910000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000
.............................................................................................TGTGACTGCATTATGAAAAT..............................................................20110.0910000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000
........................................................................................CACCGTGTGACTG..........................................................................13200.0510000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000100000000000000000000000000000000
..................................................................................................................................................GTTATTTTCTT..................11200.0510000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.............................................................................................TGTGACTGCATTATGAAAATTA............................................................22200.0511000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
panTro4
ggaccccagcctggccacacctgcttacagggcactctcaggtgcccacacatactacaataattttcataatgcaatcacacacaatcaccatgtgactgcattatgaaaattcttctagtgtgatttacagctctgtcaggtcagttattttcttctgtatactcgctattttSizeHit CountTotal NormTotal
No Reads
rheMac3
-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------SizeHit CountTotal NormTotal
No Reads
mm10
-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------SizeHit CountTotal NormTotalSRR042455
blood		SRR042459
blood		SRR042460
blood		SRR069834
blood		SRR073954
blood		SRR073955
blood		SRR525238
Blood		SRR525237
Blood		SRR042456
bone marrow		SRR042457
bone marrow		SRR042461
bone marrow		SRR042462
bone marrow		GSM317181
brain		GSM317182
brain		GSM361394
brain		GSM361395
brain		GSM361398
brain		GSM361399
brain		GSM361402
brain		GSM361407
brain		GSM361408
brain		GSM361415
brain		GSM361430
brain		GSM510444
brain		SRR037904
brain		SRR037905
brain		SRR037906
brain		SRR037907
brain		SRR038741
brain		SRR038744
brain		SRR039610
brain		SRR042477
brain		SRR060845
brain		SRR206939
brain		SRR206940
brain		SRR206941
brain		SRR206942
brain		SRR345196
brain		SRR345197
brain		SRR345198
brain		SRR345199
brain		SRR345200
brain		SRR345201
brain		SRR345202
brain		SRR345203
brain		SRR345204
brain		SRR345205
brain		SRR345206
brain		SRR345207
brain		SRR037919
embryo		SRR037920
embryo		SRR037921
embryo		SRR037922
embryo		SRR037923
embryo		SRR037924
embryo		SRR037925
embryo		SRR037926
embryo		SRR037927
embryo		SRR037928
embryo		SRR037929
embryo		SRR037930
embryo		SRR391845
embryo		SRR391846
embryo		SRR391847
embryo		SRR391848
embryo		SRR391849
embryo		SRR391850
embryo		SRR391851
embryo		SRR391852
embryo		SRR391853
embryo		SRR116846
epididymis		GSM566419
fibroblast		GSM566420
fibroblast		SRR039183
fibroblast		SRR039184
fibroblast		SRR039185
fibroblast		SRR039186
fibroblast		SRR042475
fibroblast		SRR390297
fibroblast		SRR390298
fibroblast		SRR042484
salivary gland		SRR042476
heart		SRR095853
heart		SRR095855BC1
heart		SRR095855BC10
heart		SRR095855BC2
heart		SRR095855BC3
heart		SRR095855BC4
heart		SRR095855BC5
heart		SRR095855BC6
heart		SRR095855BC7
heart		SRR095855BC8
heart		SRR095855BC9
heart		SRR065052
jejunum		SRR065053
jejunum		SRR065054
jejunum		SRR065055
jejunum		SRR065056
jejunum		SRR042480
kidney		SRR040488
liver		SRR042479
liver		SRR065045
liver		SRR065046
liver		SRR065047
liver		SRR065048
liver		SRR065049
liver		SRR065050
liver		SRR077864
liver		SRR077865
liver		SRR077866
liver		SRR042478
lung		SRR042468
lymph		SRR042469
lymph		SRR042470
lymph		SRR042472
lymph		SRR042473
lymph		SRR039152
muscle		SRR039153
muscle		SRR039154
muscle		SRR042483
muscle		SRR014234
ovary		SRR037896
ovary		SRR037897
ovary		SRR037898
ovary		SRR037899
ovary		SRR042486
ovary		SRR042481
pancreas		SRR065058
pancreas		SRR065059
pancreas		SRR042482
skin		SRR042463
spleen		SRR042465
spleen		SRR042466
spleen		SRR042467
spleen		SRR042471
spleen		SRR042487
spleen		SRR059768
spleen		SRR059769
spleen		SRR059770
spleen		SRR059771
spleen		SRR059772
spleen		SRR059773
spleen		GSM475281
testes		GSM509275
testes		GSM509279
testes		SRR014231
testes		SRR014235
testes		SRR014236
testes		SRR028731
testes		SRR037900
testes		SRR037901
testes		SRR037902
testes		SRR037903
testes		SRR042485
testes		SRR051939
testes		SRR051940
testes		SRR069809
testes		SRR069810
testes		SRR069811
testes		SRR248523
testes		SRR248524
testes		SRR248525
testes		SRR248526
testes		SRR248527
testes		SRR363956
testes		SRR363957
testes		SRR363958
testes		SRR363959
testes		SRR363960
testes		SRR363963
testes		SRR363964
testes		SRR042464
thymus		SRR059765
thymus		SRR059766
thymus		SRR059767
thymus		SRR032476
uterus		SRR032477
uterus
No Reads
rn5
-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------SizeHit CountTotal NormTotal
No Reads
canFam3
-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------SizeHit CountTotal NormTotal
No Reads
monDom5
-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------SizeHit CountTotal NormTotal
No Reads

Generated: 12/12/2014 at 11:26 AM