D. melanogaster 972-979 Cluster Investigation

TODO

Determine if what I've discovered is indeed new and not a duplicated known miRNA. There are two ways of doing this:
1. Perform an all-by-all similarity comparison of the new candidate loci against the known miRNA per species. This is only done for droWil1 and droVir3.
2. ~~Looking at uniquely mapped reads should tell us if the new miRNA candidates are adjacent repeats of each other or not.~~

~~Need to be cautious of cross-mapped reads at the new candidate loci.~~

Only looking at higher confidently mapped reads.
Reads that are repeatedly mapped (and have equal edit distances to more than one mapping locations) are ignored.
However, if the miRs are duplicates, then removing repeated mapped reads could get rid of genuine supported reads.

Add fold structure images for each new candidate loci. This is only done for droWil1 and droVir3.
Can we resequence the simulans' region of this cluster (and other miRNA clusters)? It is very strange to have 4 new candidates found in sechellia and only one in simulans given that the species are so similar. Also simulan's ortholog appears on two separate "chromosomes". The region from 972-977 belongs to chrX whereas the region from 978-979 belongs to chrX_random.
For 975 and 4966, the MAF alignment is ambiguous. There appear to be two chains comprising the net in this area although both chains lie on the same chromosome.

Overview

D. melanogaster miRNA similarity

The heatplot below shows the similarity of the mature region of each miRNA within this cluster. Similarity was computed from BLASTN. It is identical to the bitscore reported from BLAST. As shown in this figure, all the miRs (i.e. mature regions of the miRNA) within this cluster are distinct despite several of the miRNA being adjacent to each other on the X chromosome.

Candidate loci details

Below, you will find a series of UCSC browser screenshots for each of the candidate miRNA discovered using the small RNA-seq data. The list is broken down by species.

D. simulans

Candidates

Name	Coordinate
moh-dsim-1	chrX:15015576-15015647

Cluster view

chrX:15010656-15019087

974/dsim - 2499/dsim

Detail Images

D. sechellia

Candidates

Name	Coordinate
moh-dsec-1	super_8:1727806-1727868 +
dme-mir-4966-as	super_8:1734676-17347376 -
moh-dsec-2	super_8:1734853-1734914 +
moh-dsec-2-as	super_8:1734852-1734911 -
moh-dsec-3	super_8:1735027-1735079 +

Cluster view

super_8:1727313-1739049

D. yakuba

Cluster view

chrX:11883066-11893435

No new miRNA discovered in this cluster.

D. erecta

Candidates

Name	Coordinate
moh-dere-1	scaffold_4690:9689612-9689663

Cluster view

scaffold_4690:9681652-9691994

D. ananassae

Candidates

Name	Coordinate
moh-dana-1	scaffold_13417:2472648-2472875
moh-dana-1as	scaffold_13417:2472784-2472893
moh-dana-2	scaffold_13417:2467915-2468008
moh-dana-3	scaffold_13417:2461028-2461095
moh-dana-4	scaffold_13417:2460923-2460984
moh-dana-5	scaffold_13417:2460722-2460792

Cluster view

scaffold_13417:2458998-2479950

D. pseudobscura

No orthologs found.

D. persimilis

No orthologs found.

D. willistoni

Candidates

Name	Coordinate
moh-dwil-1	scaffold_181096:7946212-7946276
moh-dwil-2	scaffold_181096:7946382-7946453
moh-dwil-3	scaffold_181096:7949753-7949826
moh-dwil-4	scaffold_181096:7955395-7955470
moh-dwil-5	scaffold_181096:7956441-7956514
moh-dwil-6	scaffold_181096:7960633-7960716
moh-dwil-7	scaffold_181096:7960793-7960871
moh-dwil-8	scaffold_181096:7960964-7961040
dme-mir-973-droWil1	scaffold_181096:7946479-7946569
dme-mir-974-droWil1	scaffold_181096:7946634-7946703
dme-mir-975-droWil1	scaffold_181096:7956619-7956705
dme-mir-976-droWil1	scaffold_181096:7956783-7956870
dme-mir-977-droWil1	scaffold_181096:7956951-7957029
dme-mir-978-droWil1	scaffold_181096:7961127-7961200

Cluster view

scaffold_181096:7945397-7962301

972 - 974 / dwil

974 - 975 / dwil

977 - 979 / dwil

The similarity comparison between these new candidates and the known orthologs can be seen in the below heatmap. What becomes apparent immediately is the similarity between the dme-mir-975-droWil1 ortholog and that of the candidate locus 8.

droWil1HeatMap

The similarity of these two loci becomes clearer in their alignment:

droWil1_975_8

D. virilis

Candidates

Name	Coordinate
droVir3_1	scaffold_13042:917881-917949
droVir3_2	scaffold_13042:917745-917815
droVir3_3	scaffold_13042:912568-912655
droVir3_4	scaffold_13042:912399-912465
droVir3_5	scaffold_13042:907097-907164
droVir3_6	scaffold_13042:903357-903448
droVir3_7 & 7as	scaffold_13042:903190-903272
droVir3_8	scaffold_13042:903013-903106
droVir3_9	scaffold_13042:902868-902935
droVir3_10	scaffold_13042:902694-902766
dme-mir-973-droVir3	scaffold_13042:918354-918425
dme-mir-974-droVir3	scaffold_13042:917565-917638
dme-mir-975-droVir3	scaffold_13042:906925-906995
dme-mir-976-droVir3	scaffold_13042:906747-906812
dme-mir-977-droVir3	scaffold_13042:906580-906653

Cluster view

Notes:

Firstly, the droVir3_3 candidate locus may be a duplicate droVir3_4, since all the reads at the position scaffold_13042:912568-912655 are repeats and also map to droVir3_3. An example of two such high read count sequences are:

Read ID	V116_22290_103
Read Sequence	GGATAGCTACCGTTCAATGTACAA
First hit	scaffold_13042:912574 (droVir3_3)
Second hit	scaffold_13042:912441 (droVir3_4)

Read ID	V116_13609_197
Read Sequence	TAGCTACCGTTCAATGTACAA
First hit	scaffold_13042:912577
Second hit	scaffold_13042:912444

Secondly, the similarity between the candidate loci and the virilus orthologs can be seen in the heatmap below. I should point out that he similarity between dme-mir-974-droVir3 ortholog and droVir3_2 candidate locus.

Here is the alignment of candidate locus droVir3_2 with dme-mir-974-droVir3 ortholog:

Thirdly, I'm still puzzled why the droVir_7 candidate locus' mature and star sequences are so similar. What is even more bizarre is that there are both sense and antisense reads for this locus. How did this locus evolve? What is its expression vehicle given that all miRNAs in this location are on the negative strand?